ID: 1164826998

View in Genome Browser
Species Human (GRCh38)
Location 19:31291123-31291145
Sequence CTGCTCCTCTAGGGAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164826995_1164826998 -6 Left 1164826995 19:31291106-31291128 CCAATGACAGGCTGCGGCTGCTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 173
1164826992_1164826998 10 Left 1164826992 19:31291090-31291112 CCAGTGGTGGCGTAAGCCAATGA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 173
1164826991_1164826998 18 Left 1164826991 19:31291082-31291104 CCGAGTGGCCAGTGGTGGCGTAA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 173
1164826990_1164826998 19 Left 1164826990 19:31291081-31291103 CCCGAGTGGCCAGTGGTGGCGTA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164826998 Original CRISPR CTGCTCCTCTAGGGAACCCA TGG Intronic
900989605 1:6092290-6092312 CAGATCCTCCAGGGAGCCCAGGG + Intronic
902392234 1:16113326-16113348 CTGCTCCTCTGGGTGACCCTGGG + Intergenic
903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG + Intergenic
906279139 1:44541696-44541718 CTGCTTCTCAAGGCAGCCCAGGG + Intronic
906337564 1:44947158-44947180 CTGCTCCTCTAGAGAAGCCAGGG + Intronic
916177551 1:162055283-162055305 CAGCACCTCTAGGGAGGCCAGGG + Intergenic
916518851 1:165545057-165545079 CTGCTACTCCAGTCAACCCAAGG - Intronic
916531149 1:165657864-165657886 CTGCACTTCCAGGGAACCCTAGG + Intronic
916622607 1:166516944-166516966 CTGCTCCACAAGGAAAGCCATGG - Intergenic
919797005 1:201326959-201326981 CTGGTCCTCTAGGTAGCCCTGGG - Intronic
923270107 1:232347822-232347844 CTGCTCCTATAGGAAACACATGG + Intergenic
923751126 1:236746968-236746990 GTGCCCTTCTAGGGAAGCCAAGG + Intronic
1062882094 10:987663-987685 CCGCTCCCTTTGGGAACCCAGGG - Intergenic
1065588208 10:27240745-27240767 CTGCTCCGCCAGGGTCCCCAGGG - Exonic
1070383521 10:75902867-75902889 CTGCTCCTTTAGGGCTCCCCAGG + Intronic
1073207099 10:101775206-101775228 CTGCTCCTCTAGGAAGGCCCGGG - Exonic
1074382952 10:112995142-112995164 CTCCTCCTCAGGGGAACCCCTGG + Intronic
1074845005 10:117390014-117390036 CTGCTCCTCTGGCAAAGCCAGGG + Intergenic
1075795525 10:125116968-125116990 CTGGTCCTTCAGGGAACCCATGG - Intronic
1076559687 10:131353272-131353294 CTGTCCCTCCAGGGAAGCCAAGG - Intergenic
1076903953 10:133353086-133353108 CTCCTGCTGTAGGGAGCCCAGGG - Intergenic
1077409250 11:2395798-2395820 CGGTGGCTCTAGGGAACCCATGG - Intronic
1078147235 11:8730312-8730334 CGGCTCCTCCAAGGAGCCCAAGG + Exonic
1079555975 11:21759505-21759527 CTGCTACACTGGAGAACCCAAGG + Intergenic
1082952443 11:58831674-58831696 TTGCTCCTCTAGGCAACACAAGG - Intergenic
1083490637 11:63012792-63012814 GTGCTCCTGGAGGGAACGCAGGG + Intronic
1083691132 11:64409600-64409622 CTGCACCTCTTGGGAGCTCAGGG + Intergenic
1084531313 11:69729467-69729489 CTCCTCCACCAGGGACCCCAGGG + Intergenic
1084571768 11:69964016-69964038 CTGCCACTCAAGGGAACCGACGG - Intergenic
1084674057 11:70624094-70624116 CCCCTCCCCTAGGGAAACCAGGG - Intronic
1085271619 11:75273285-75273307 CTGCTTCTCTCAGCAACCCATGG + Intronic
1089209569 11:116791144-116791166 CTGATCCTCTGGGGGAACCAAGG + Intronic
1091027767 11:132157401-132157423 CTGCTCCTGTAGATACCCCAAGG - Intronic
1091596844 12:1884129-1884151 CTGCTCCTCTTAGGGGCCCATGG + Intronic
1092017147 12:5168920-5168942 CTGCCTCTCTGGGGAACCCGGGG + Intergenic
1092869010 12:12788812-12788834 CGGCTTCTCTAGGGACTCCATGG + Exonic
1095832710 12:46604464-46604486 GTGCACCACTAGGGGACCCAAGG + Intergenic
1096552505 12:52382405-52382427 CATCTTCTCTAGGGCACCCAAGG - Intronic
1097275651 12:57811667-57811689 CTGAGCCACTGGGGAACCCAAGG - Intronic
1097573019 12:61356580-61356602 CTGCTCCTGGAGGCACCCCATGG - Intergenic
1097794008 12:63843789-63843811 CTGCTCCGCTAGGAAACGCCTGG - Intergenic
1098845161 12:75525777-75525799 CTGATCCTCTAGGGATTCTATGG - Intergenic
1100286341 12:93170253-93170275 CTTCACCTCTAGGGAATCTATGG + Intergenic
1102042917 12:109812049-109812071 CTGGTCCTTTAGGAAGCCCAGGG - Intronic
1102358092 12:112257370-112257392 CTGCTGCTCTAGAGAAACCCAGG + Intronic
1104935048 12:132360060-132360082 CTTCTCCTCTGGGGACACCATGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107622947 13:42252437-42252459 CTGCTTCTCTAGGAATCCAAGGG + Intronic
1108683424 13:52798942-52798964 TTGCTCCTCTTAGGAGCCCAGGG - Intergenic
1108724821 13:53168911-53168933 CCGCTCCTTTAGAGAAACCAAGG - Intergenic
1110411636 13:75210191-75210213 CTGCTACTCCAGTGAACACATGG - Intergenic
1110668765 13:78150726-78150748 CTGTCCCTCTAGAGAACCCTGGG + Intergenic
1112008348 13:95273463-95273485 CTGCTCCTCCAGGGAACTGGTGG - Intronic
1116950061 14:50871411-50871433 GAGCTACTCTAGGGAAGCCACGG - Intronic
1122652604 14:103233664-103233686 CTGTGGCTCTTGGGAACCCAAGG + Intergenic
1123679201 15:22745532-22745554 CTGCTCCTCTAAGGAACACTTGG + Intergenic
1123708160 15:22965781-22965803 CTGCTGCTCTGGGGACACCAGGG - Intronic
1123994552 15:25709585-25709607 CTCCTCGTCTGGGGCACCCAGGG - Intronic
1124106251 15:26740562-26740584 CTCCTCCTCTGGAGCACCCAAGG + Intronic
1124331421 15:28819982-28820004 CTGCTCCTCTAAGGAACACTTGG + Intergenic
1125886859 15:43235754-43235776 CTGCTCCTCTTTGGGAGCCATGG + Exonic
1127840386 15:62826582-62826604 CTTCTCCTCTGGAGGACCCATGG - Intronic
1128939859 15:71779168-71779190 CTTCTCTTCTAGGGAGCCCCAGG + Exonic
1129125557 15:73437893-73437915 CTTGTCATCTAGGGGACCCAAGG + Intergenic
1130806278 15:87326903-87326925 CCGCTCTCCAAGGGAACCCATGG - Intergenic
1130960585 15:88656284-88656306 CTGCACATCTAGGGCACCCCAGG + Exonic
1131829218 15:96343767-96343789 CTGCTCCTGTAGGGATGCCTGGG - Intergenic
1132646547 16:1001904-1001926 TTTCTCCTCCAGGGAACCCTGGG + Intergenic
1134286406 16:12865781-12865803 CTGCTCCTCTTGGTTACTCAGGG + Intergenic
1136236879 16:28919795-28919817 CTGCTTCTCCAGGGAGTCCAGGG + Exonic
1137010028 16:35312325-35312347 CTGCCCCTTTAGTGACCCCACGG + Intergenic
1138131818 16:54486214-54486236 CTGCTCCTCCAGGGAGCCTCAGG - Intergenic
1144859365 17:18290771-18290793 CTGCTCCACTAGAGAACTCAGGG + Intronic
1145012461 17:19377752-19377774 CTGCTCCTCTGCGGAGCCCGCGG - Exonic
1145288724 17:21526047-21526069 CTTCTTCTCTAGGCTACCCACGG - Intronic
1145388948 17:22440345-22440367 CTTCTTCTCTAGGCTACCCATGG + Intergenic
1145774626 17:27519346-27519368 CTGCTCCCTTAGGGCTCCCAGGG + Intronic
1146372672 17:32275293-32275315 CTGCTCCTCCTGGGTACCCAAGG + Intronic
1152680450 17:81665270-81665292 GTGCTCCTCCAGGGCAGCCAGGG + Exonic
1152703591 17:81831928-81831950 TTCCTCCTCCAGGGGACCCAAGG + Intronic
1158865886 18:61637189-61637211 CTGCTCCTCTAGAAAATGCATGG - Intergenic
1158867888 18:61655525-61655547 CTGCTAGGCTAGGGGACCCACGG + Intergenic
1162256929 19:9498346-9498368 CGGCTCCTCTAGGGGACCGAAGG + Intronic
1164691725 19:30215812-30215834 CTTCAGCTCTAGGGAACCCCAGG - Intergenic
1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG + Intronic
1164934642 19:32201447-32201469 CTCCTCCTCCAGGAAGCCCATGG - Intergenic
1165520727 19:36311923-36311945 CTCCTACTCTAGGGGACACAGGG - Intergenic
1165623345 19:37266662-37266684 CTCCTACTCTAGGGGACACAGGG + Intergenic
1165739952 19:38199123-38199145 CCACTGCTCCAGGGAACCCAGGG - Intronic
1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG + Intergenic
1167661147 19:50796788-50796810 CAGCTCCTCTAGGGAATGCCGGG - Intergenic
925360538 2:3277662-3277684 CTGCTACTCTAAGGAGCCCGGGG + Intronic
928439215 2:31277671-31277693 CTGCTCATCTGGGGAGCCCTTGG + Intergenic
930008151 2:46914546-46914568 TTGTTCATCTAGGGAGCCCAAGG + Intronic
934709017 2:96503232-96503254 CTGCTTCTCAAGGGCTCCCAGGG - Intronic
939275791 2:139994127-139994149 CTCCTCCTCTATGGAACCTGGGG - Intergenic
943719212 2:191185415-191185437 CTGCACCTCCAGGGAAGCCCAGG - Intergenic
946158155 2:217820460-217820482 CTGCTCCCCTAGTCATCCCATGG + Intronic
947617763 2:231569241-231569263 CTCCTCCCCTGGGGCACCCAAGG - Intergenic
1170790446 20:19504566-19504588 TAGTTCCTCAAGGGAACCCATGG - Intronic
1171994872 20:31723465-31723487 CTGCACCTCTCCGGAGCCCAGGG + Intronic
1173768254 20:45633459-45633481 GTGCTACTCTAGTGAACACATGG + Intergenic
1175092844 20:56519201-56519223 CTGCTTCTGAAGGAAACCCAGGG - Intronic
1176310009 21:5144566-5144588 TTCCTCCTCTAAGGAACCCTCGG + Intronic
1179847047 21:44117466-44117488 TTCCTCCTCTAAGGAACCCTCGG - Intronic
1179980728 21:44894455-44894477 CTGCTCCCCTGGGGAGCCCATGG - Intronic
1181282057 22:21727307-21727329 CTGTTGCACTGGGGAACCCATGG + Intronic
1181871879 22:25905897-25905919 CTGCTCATTTAAGGAACACAAGG - Intronic
1182748335 22:32622670-32622692 CAGCTCAACAAGGGAACCCAGGG - Intronic
1183157261 22:36085067-36085089 CTCCTCCTCTCTGGAAGCCAGGG + Intergenic
1183228952 22:36568944-36568966 CTGCTCCTCCACAGACCCCAGGG + Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1184096947 22:42321285-42321307 CGGCCCCTCTGGGGAACACAAGG + Intronic
1184342132 22:43891860-43891882 CTCCTCCTCTAAGAAGCCCATGG + Exonic
1184437438 22:44487972-44487994 CTGGTCCTCCAGGGCACACAGGG + Intergenic
1184470206 22:44691879-44691901 CTCCTCCACGAGGGAAGCCAGGG + Intronic
1185274386 22:49944076-49944098 CTGCCCCTCTTGGGGGCCCAGGG - Intergenic
949809994 3:7996813-7996835 TTGTTCCTCTATGGAACACAGGG - Intergenic
950724282 3:14906422-14906444 CTGCTCCTCTAGGGAAAGAGAGG - Intronic
951086890 3:18522038-18522060 CTGTCCCTCTAGAGAACCCTGGG + Intergenic
952825011 3:37517499-37517521 CTGCTCCTCGAGGGCTCCCTGGG - Exonic
953213504 3:40897094-40897116 ATAGTCCTCGAGGGAACCCAGGG - Intergenic
954103698 3:48397875-48397897 CTGGTCCTCCAAGGGACCCAGGG + Intronic
957362810 3:79181141-79181163 CATCTCCTTCAGGGAACCCACGG + Intronic
961751097 3:129095365-129095387 CTGGCCCTCTAGGGTCCCCAGGG + Intronic
962186891 3:133269816-133269838 CTCCTCCTCTGGGGTTCCCAAGG + Intronic
962358211 3:134713240-134713262 CACCTCCACTATGGAACCCAGGG + Intronic
962839355 3:139220101-139220123 CTACTCCTGCAGGGAACCTAAGG + Intronic
963922930 3:150923483-150923505 ATGCTTCTCTAGGGCTCCCAAGG - Intronic
966775157 3:183537155-183537177 CTGCTCCTCTGGGAGATCCATGG + Intronic
967497588 3:190159111-190159133 CTTCTCCTCTCAGGAATCCAGGG + Intergenic
967975251 3:195030851-195030873 CTCCTCCACTTGGGAAGCCAGGG + Intergenic
968110316 3:196040893-196040915 CTGCTTCTCTTCGGAAACCATGG - Intronic
969508092 4:7600559-7600581 GTGCTCCTCTGGGGAAACCTGGG + Intronic
969518013 4:7659375-7659397 CTGGTCCTCCAGGGAAGGCAGGG - Intronic
969560044 4:7941040-7941062 CTGCTCCTCTGTGGGTCCCAGGG + Intergenic
971200885 4:24508191-24508213 CTGCTCCTCCTGGGAAGCCCAGG + Intergenic
971660384 4:29407044-29407066 CTGCACCTCCAGTGAATCCATGG - Intergenic
972771282 4:42199500-42199522 CTGTACCTCTAGGGAAGCCCTGG + Intergenic
982092430 4:151892175-151892197 CTGCTCAGCTAGGGAAAGCAGGG + Intergenic
984943455 4:184953415-184953437 CTGATTCTGTAGGGAACCCTAGG - Intergenic
985544439 5:502120-502142 CTGATTCTCTAGGGAACCGTGGG - Intronic
985675986 5:1231549-1231571 CTGTTCCCCCAGGGACCCCAGGG - Intronic
985975585 5:3416948-3416970 CTGCTCGTCTAGGGGAGCCCTGG + Intergenic
986674780 5:10174139-10174161 CTGCTCATCAAGGGAACTCCTGG + Intergenic
997621860 5:135304399-135304421 CTGCCCCACTGGGGAGCCCATGG - Intronic
1001080585 5:168664626-168664648 AGGCTCCTCTAGGGAACCTGAGG + Intronic
1001455660 5:171858056-171858078 CTTCTCTTCTAGGCAGCCCAGGG + Intergenic
1002177396 5:177409010-177409032 CTCCTCCTCCCGGGAACCCTTGG - Intronic
1002431658 5:179207657-179207679 GTGCTCCTCTAGGACGCCCAGGG + Exonic
1006066687 6:31467246-31467268 CTGCTCCTCTGGGGTTGCCATGG + Intergenic
1006779362 6:36621681-36621703 CAACACCTCTAGGGAACACATGG + Intergenic
1013013430 6:106140670-106140692 CTGGTCCTCTTGAGAAACCAAGG + Intergenic
1016293682 6:142551459-142551481 CTGCTCCCCTTGGCAACCCAGGG + Intergenic
1018344393 6:162885662-162885684 CTGCTCCTCAAGGAAATACAGGG - Intronic
1018406932 6:163495306-163495328 CTGCTCCTCAAGGAAATACAGGG - Intronic
1018927342 6:168215414-168215436 CTGCCCCTCCAGGGAAGCCCTGG + Intergenic
1019034071 6:169040254-169040276 CTGCTCCTCATGGGAGTCCAGGG - Intergenic
1019280757 7:198838-198860 CTTCTCATCTGGGGAAGCCAGGG + Intronic
1019625091 7:2011873-2011895 CTGCTTCTGGAGGGTACCCAGGG + Intronic
1022617580 7:31947548-31947570 CTGCTCCTATAGGGAAGGCCTGG - Intronic
1025028258 7:55535544-55535566 ATGCACCTCTAGAGAACCCTAGG + Intronic
1025110532 7:56212585-56212607 CTGATCCTCTGGGGAACACAGGG - Intergenic
1026307390 7:69153836-69153858 CTGATCCTCTGGCGAACACACGG + Intergenic
1028631853 7:92943575-92943597 CTCCTCCTTTAGGAAAGCCAGGG - Intergenic
1030160942 7:106508091-106508113 CTGGTCTTCAATGGAACCCAGGG + Intergenic
1031401409 7:121329356-121329378 CTGTTCCCCTACGGAGCCCAAGG + Exonic
1032785769 7:135198141-135198163 CTTTTCCTCTAGGGCACCAAGGG - Exonic
1034257108 7:149730597-149730619 CTGGTCCTCTGGGGAACGCATGG - Intronic
1036010487 8:4716203-4716225 CTGCTCATCTAGAGAACAGAAGG + Intronic
1036558803 8:9884188-9884210 CAGCTCCTCCAGGGTTCCCAGGG - Intergenic
1036615136 8:10381894-10381916 CTGCCACTCTTGGGACCCCAGGG + Intronic
1043098917 8:76014764-76014786 CTGCTCCTAGAGGAAACACAGGG + Intergenic
1045111243 8:98940766-98940788 CTCCTCCTCTGGGGAAGTCAGGG + Intronic
1045290727 8:100830358-100830380 CTGCAGCTCTAGGTAACCAAAGG + Intergenic
1047334799 8:123925227-123925249 CTGCTCTATGAGGGAACCCAGGG + Intronic
1048304995 8:133278039-133278061 CCGCTCCCCTGGGGAACACAAGG + Intronic
1048603159 8:135940770-135940792 CTGTTCCTCGAGGCACCCCAGGG - Intergenic
1051147178 9:14039736-14039758 ATGCTACTCTAGTGAACACATGG - Intergenic
1056385401 9:86092607-86092629 CTGCTCCCATTGGGAGCCCAGGG - Intronic
1056856167 9:90131511-90131533 CTCCTCCTCTAGGCAGACCAGGG - Intergenic
1058456663 9:105143887-105143909 TTGCTTCTCTAGGGAACAAAGGG - Intergenic
1061835764 9:133328468-133328490 CTTCACCTCTTGGGAACCCATGG + Intergenic
1191933860 X:66405028-66405050 CTGTGCCCCTAGGGAACCGAAGG + Intergenic
1192135842 X:68599478-68599500 CTGCTGCTCTAAAGGACCCATGG + Intergenic
1200056151 X:153462436-153462458 CTGCTTCTCTAGGCATCCCTGGG - Intronic
1200109718 X:153734084-153734106 CTGCTCCTGTGGGGAATCTAAGG + Intronic
1201404842 Y:13639123-13639145 CTGTTTCTCTATGGAGCCCAGGG - Intergenic