ID: 1164828380

View in Genome Browser
Species Human (GRCh38)
Location 19:31301197-31301219
Sequence CACCACCCGCTTCTTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164828380_1164828381 -8 Left 1164828380 19:31301197-31301219 CCTCTGCAAAGAAGCGGGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1164828381 19:31301212-31301234 GGGTGGTGCAGACTCAGAGATGG 0: 1
1: 0
2: 3
3: 38
4: 350
1164828380_1164828382 -7 Left 1164828380 19:31301197-31301219 CCTCTGCAAAGAAGCGGGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1164828382 19:31301213-31301235 GGTGGTGCAGACTCAGAGATGGG 0: 1
1: 0
2: 3
3: 17
4: 221
1164828380_1164828383 -6 Left 1164828380 19:31301197-31301219 CCTCTGCAAAGAAGCGGGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1164828383 19:31301214-31301236 GTGGTGCAGACTCAGAGATGGGG 0: 1
1: 0
2: 3
3: 17
4: 227
1164828380_1164828385 20 Left 1164828380 19:31301197-31301219 CCTCTGCAAAGAAGCGGGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1164828385 19:31301240-31301262 CCCCACCACGTCTCCCTCTCAGG 0: 1
1: 0
2: 2
3: 27
4: 419
1164828380_1164828387 21 Left 1164828380 19:31301197-31301219 CCTCTGCAAAGAAGCGGGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1164828387 19:31301241-31301263 CCCACCACGTCTCCCTCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164828380 Original CRISPR CACCACCCGCTTCTTTGCAG AGG (reversed) Intronic
903401276 1:23051796-23051818 CACCACCAGCTTCTTTGTTTTGG + Intronic
904962284 1:34343450-34343472 TACCATCAGCTTCTTTGCACAGG - Intergenic
906114665 1:43348821-43348843 CACCGCACGCTTCTTTGCTCAGG + Exonic
907914847 1:58859368-58859390 CACCACCAGATTGTTTGCTGGGG - Intergenic
910193812 1:84620850-84620872 CGCCACCCGCTTCCCTGCAGAGG - Intergenic
910948175 1:92616262-92616284 CAGCACCTGCATCTTTGAAGAGG + Intronic
912631875 1:111253352-111253374 CACCATCAGCTTCTCAGCAGAGG - Intergenic
912984109 1:114409164-114409186 CACCACCTACTTCTTTCTAGAGG - Intronic
915861378 1:159448613-159448635 CTCCACCTTCTTGTTTGCAGGGG - Intergenic
919173667 1:193991036-193991058 CAGCACCCTATTTTTTGCAGTGG + Intergenic
922707099 1:227795529-227795551 CACCACCCCCTTCTTCCCACGGG + Intergenic
924138588 1:240998597-240998619 CACCAGCCCCTACATTGCAGAGG + Intronic
1063378130 10:5566302-5566324 GACCACCCACATCTTGGCAGGGG + Intergenic
1069866965 10:71510155-71510177 GGCCTCTCGCTTCTTTGCAGTGG + Intronic
1072019607 10:91384974-91384996 TACCACCCCCTTCTTTCCTGGGG - Intergenic
1072903295 10:99428720-99428742 CTCCAAGCGTTTCTTTGCAGCGG - Intronic
1073476702 10:103758351-103758373 CACAAAGGGCTTCTTTGCAGAGG - Intronic
1076468346 10:130701185-130701207 CAGCAAGCTCTTCTTTGCAGGGG + Intergenic
1082817878 11:57522390-57522412 CACCACCCTCTTCTACCCAGTGG + Intergenic
1082991780 11:59212826-59212848 CACCATCCTCTTCTGGGCAGCGG - Exonic
1083191974 11:61058584-61058606 CACCACCAGTTACTTTGCTGAGG - Intergenic
1083968578 11:66058294-66058316 CACCACCTTCTTCCTTACAGAGG + Exonic
1084111043 11:67014481-67014503 CAGCACCAGCTTCTCTGGAGAGG + Intronic
1084804661 11:71570472-71570494 AACCACCTGCTTCTTGGAAGAGG + Intergenic
1084805795 11:71578150-71578172 AACCACCTGCTTCTTGGAAGAGG - Intergenic
1085640620 11:78190401-78190423 CACCACCCCCTCCTTTGCCCAGG - Intronic
1088729746 11:112670585-112670607 CACCAACTGCTTTTTTACAGAGG + Intergenic
1089287344 11:117416068-117416090 AACCACCAGCTTCTTGGAAGGGG - Intergenic
1091965325 12:4735813-4735835 CACCTCCAGCTTCTGTGCAGTGG + Intronic
1092754361 12:11749435-11749457 CACCACCCCCTCCTTTGTTGGGG + Intronic
1094102283 12:26777345-26777367 CAGCACCTGCATCTTTGAAGAGG + Intronic
1096493160 12:52023804-52023826 CAGGACCCGCCCCTTTGCAGCGG - Intronic
1100657359 12:96661149-96661171 CACCCCTCTCTTCTTTGCAGAGG + Intronic
1104411119 12:128558694-128558716 CACCTCCCTCTTCCTTTCAGTGG + Intronic
1110354775 13:74554836-74554858 CACCATCTGCCTCTTTGCCGAGG - Intergenic
1110725188 13:78814734-78814756 CTCCACTTGCTTCTTAGCAGAGG - Intergenic
1112572471 13:100606661-100606683 CACCACCTGCCTCCCTGCAGTGG + Intronic
1115814915 14:37153412-37153434 CAGCACCCGCTTCCTGGCACTGG - Intronic
1118979663 14:70706262-70706284 CTTCACCCTCTTCTCTGCAGTGG - Intergenic
1119805351 14:77478536-77478558 CACCAGCCACTCCTATGCAGGGG + Intronic
1132643806 16:989735-989757 CACAGCCCCCTTGTTTGCAGTGG - Intergenic
1136564460 16:31061638-31061660 CACCACCAGCTCCTGTGCAGGGG + Exonic
1139653888 16:68375993-68376015 CGCCAGCGGCTTCTATGCAGAGG - Intronic
1142193252 16:88727522-88727544 CACCACCCCCGCCTCTGCAGAGG - Intronic
1144469500 17:15524905-15524927 CACCACTCGGCTCTTGGCAGTGG + Intronic
1144926855 17:18818772-18818794 CACCACTCGGCTCTTGGCAGTGG - Intergenic
1147565222 17:41531984-41532006 CACCCCCAGCTTCTTTCCTGTGG - Intergenic
1149313676 17:55420698-55420720 CACCACCAGCATGTTTGCTGGGG - Intronic
1149993452 17:61395410-61395432 CAGCACCGGCTTCTTAGGAGTGG + Intergenic
1151550329 17:74819047-74819069 CAGCACCCGCTTCTCTGCCTGGG + Intronic
1152513579 17:80807342-80807364 CACCACCCTTTTTTTTGGAGCGG + Intronic
1153972048 18:10235852-10235874 CAAAACCTGCTTCCTTGCAGGGG + Intergenic
1156477038 18:37412002-37412024 CAGCACCCTTTTCTTTGCTGTGG + Intronic
1160780476 19:875730-875752 CTCCACCCGTTACTTGGCAGGGG - Intronic
1160912003 19:1478874-1478896 CAGCACGCGCTTCTTTGCCTTGG + Exonic
1162420401 19:10562870-10562892 CACAACCCCCTTCTTTGCCGTGG + Intronic
1164828380 19:31301197-31301219 CACCACCCGCTTCTTTGCAGAGG - Intronic
1165315018 19:35049455-35049477 CACCCCTCCCTTCTCTGCAGTGG + Exonic
1168270217 19:55245742-55245764 CTCCACCCTCTTCTCTGCACCGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932573790 2:72951766-72951788 CACCACCTGCTCCTGGGCAGAGG + Intronic
936970263 2:118170022-118170044 CACCCCCTGCTTCTCTGCTGTGG + Intergenic
938181848 2:129191305-129191327 CACCTCCCGCCTCTATGCTGTGG + Intergenic
938258425 2:129878116-129878138 CACCTCCCACTCCTTCGCAGGGG + Intergenic
938595972 2:132787461-132787483 CCCCACACGCTTATGTGCAGTGG + Intronic
940606169 2:155926291-155926313 CAGCACCTGCATCTTTGAAGAGG - Intergenic
941389747 2:164897206-164897228 CACCACATGCTTCCTTACAGGGG - Intronic
1172814545 20:37676075-37676097 CACCACCACCTTCTCTGCGGGGG + Intergenic
1175196742 20:57249134-57249156 CACTACCTGCTTCTGTGGAGAGG - Intronic
1175306930 20:57982647-57982669 CACCGGGTGCTTCTTTGCAGAGG + Intergenic
1175725070 20:61312568-61312590 CTGCACCCCCTTCTTTGCTGAGG + Intronic
1175725996 20:61318883-61318905 TACCACCGGCATCTGTGCAGTGG - Intronic
1175767554 20:61601728-61601750 CACCACCCAGGTCTGTGCAGAGG + Intronic
1177912943 21:27054310-27054332 CAGCACCTGCATCTTTGAAGAGG + Intergenic
1178440616 21:32595199-32595221 CACCACCCCCTTCTGTTCTGTGG + Intronic
1180060966 21:45384839-45384861 CACCAGCCGGTTCTAGGCAGTGG - Intergenic
1182982647 22:34685881-34685903 TACCACCCCCTTCTATGCATTGG + Intergenic
1183746896 22:39697350-39697372 AACCACCTCCTTCTTTGCAAAGG - Intergenic
950303328 3:11900124-11900146 CACCAGCATCATCTTTGCAGAGG + Intergenic
952990878 3:38829679-38829701 CCCCATGCGCTGCTTTGCAGAGG - Intergenic
953660668 3:44889325-44889347 CAGCACCAGCTTCTCTCCAGAGG + Intronic
954746888 3:52792454-52792476 CTCCACCCACTGCTTTCCAGAGG + Intergenic
956103054 3:65788542-65788564 CATCACCAGCTGCGTTGCAGAGG + Intronic
958960030 3:100500827-100500849 TACCACCCACTTCCTTGCTGTGG - Intronic
961330520 3:126135479-126135501 CACCATCAGCTTCTGGGCAGTGG - Intronic
963127374 3:141827939-141827961 CCCCACCCGCCCCTTTGCTGAGG + Intergenic
963506319 3:146189428-146189450 CACAACTGGCTTCTTTGCTGAGG + Intergenic
965538336 3:169848044-169848066 CCCCACCTGGTGCTTTGCAGGGG + Intronic
967439362 3:189488959-189488981 CACTGCCTGCTTCTCTGCAGGGG + Intergenic
967882218 3:194309793-194309815 GACCACCCGCTTCCCTGCACAGG - Intergenic
972084990 4:35205111-35205133 CAGCACCTGCATCTTTGAAGAGG + Intergenic
974098856 4:57395079-57395101 CACCACCCCCTTCTTTAAAGAGG - Intergenic
978071375 4:104475825-104475847 CCCCACCCCCTTCTCTTCAGGGG - Intronic
984585101 4:181554254-181554276 CACCGCCCGCAGCTTTTCAGTGG - Intergenic
986513878 5:8540737-8540759 TACCACCCACTTCTTTCCACAGG - Intergenic
989536585 5:42571583-42571605 CACTGCCAGCTTCTTTGTAGGGG - Intronic
993748807 5:91639855-91639877 CACCTCCCTCTTCTTTGAGGTGG + Intergenic
994291626 5:98033895-98033917 CAGCACCTGCATCTTTGAAGAGG - Intergenic
997416365 5:133731935-133731957 CACCAGCCCCTTTTTTCCAGAGG + Intergenic
1005064889 6:21808268-21808290 CACCTCCTGCTTCTCTGCTGGGG + Intergenic
1018386231 6:163305813-163305835 CACTACCCGGTTGGTTGCAGTGG + Intronic
1020650187 7:10865519-10865541 CAGCCCCCGCTCCTTTGCAGGGG - Intergenic
1022286473 7:28958882-28958904 CACCAGCCGCTTCTGAGCAGTGG + Intergenic
1023624089 7:42099040-42099062 CACCACCCTCTCCTTGGCACGGG - Intronic
1024040130 7:45546617-45546639 CAGCACCTGCATCTTTGAAGAGG - Intergenic
1024265334 7:47602002-47602024 CCCCACCTGCTCCTGTGCAGAGG + Intergenic
1025004312 7:55343040-55343062 CTCCACCAGCTTCCCTGCAGGGG - Intergenic
1032386651 7:131530049-131530071 CACAAGCCTCTTCTTTCCAGGGG + Intronic
1037579243 8:20234949-20234971 CCCCACCCCCTTCTTAACAGAGG + Intergenic
1039432971 8:37540072-37540094 CAGGGCCAGCTTCTTTGCAGAGG + Intergenic
1040003643 8:42600090-42600112 CACCACCCCCTGCTCTGCAGTGG - Intergenic
1041370706 8:57157709-57157731 CACCACCAGCTTCTCATCAGGGG + Intergenic
1044649172 8:94476291-94476313 CACCCCCCTCTTCTTTGGACTGG + Intergenic
1045250708 8:100481396-100481418 CACCACCCGCATCCTGGCATTGG - Intergenic
1053286804 9:36855022-36855044 CAACAGCCTCTTCTTTACAGAGG - Intronic
1053503257 9:38620307-38620329 CACCACCCGCTCCTGAGCCGCGG + Intergenic
1056220371 9:84445758-84445780 GACCACCCGATTCTATGCAAGGG - Intergenic
1058040646 9:100298020-100298042 CCCCACCATCTGCTTTGCAGTGG - Intronic
1058277968 9:103070674-103070696 CATCACCTGATTCTATGCAGTGG + Intergenic
1059573738 9:115468203-115468225 CACCAGCCACTTCTCTCCAGTGG + Intergenic
1190200537 X:48356973-48356995 GACCACCCACTTTTTCGCAGTGG - Intergenic
1190667353 X:52707450-52707472 GACCACCCACTTTTTCGCAGTGG - Intergenic
1190672065 X:52750958-52750980 GACCACCCACTTTTTCGCAGTGG + Intergenic
1199877551 X:151946409-151946431 CACTACTTTCTTCTTTGCAGTGG + Intergenic
1200834960 Y:7724292-7724314 CCCCACCTACTTCTATGCAGAGG - Intergenic
1202134694 Y:21649535-21649557 CAGCACCTGCATCTTTGAAGAGG - Intergenic