ID: 1164828999

View in Genome Browser
Species Human (GRCh38)
Location 19:31306123-31306145
Sequence TGTGCCGTCGTCTCGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164828999_1164829006 2 Left 1164828999 19:31306123-31306145 CCTCCCCACGAGACGACGGCACA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1164829006 19:31306148-31306170 CACCGTGTGCGCTCATTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1164828999_1164829005 1 Left 1164828999 19:31306123-31306145 CCTCCCCACGAGACGACGGCACA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1164829005 19:31306147-31306169 CCACCGTGTGCGCTCATTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1164828999_1164829007 3 Left 1164828999 19:31306123-31306145 CCTCCCCACGAGACGACGGCACA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164828999_1164829009 6 Left 1164828999 19:31306123-31306145 CCTCCCCACGAGACGACGGCACA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1164829009 19:31306152-31306174 GTGTGCGCTCATTCCCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164828999 Original CRISPR TGTGCCGTCGTCTCGTGGGG AGG (reversed) Intronic
923515002 1:234689386-234689408 TGTGGCGTCCTCTGGAGGGGAGG + Intergenic
1063592350 10:7407258-7407280 TGTGGCCTCGTTTCCTGGGGAGG - Intronic
1067937143 10:50622831-50622853 TGTGGCGTCCTCCCGTGGGCCGG - Intronic
1077907809 11:6547363-6547385 TGTGCCCTAGTCTGGTGTGGTGG + Exonic
1078100497 11:8327765-8327787 TGTGCTGTCGTGTCCTGGGTTGG - Intergenic
1085512463 11:77095334-77095356 TGAGCCCTCATCTAGTGGGGGGG - Intronic
1097118387 12:56716060-56716082 TCTGCCGTCCTCTCCTGGGCTGG - Exonic
1113784287 13:112994326-112994348 TGTGCCGGTGTCTCGGGCGGGGG + Intronic
1122350107 14:101084124-101084146 TTTGCCTTTGTCTGGTGGGGTGG + Intergenic
1132591728 16:729035-729057 TGTGCCGTCGACTCTGGGCGAGG + Exonic
1139294678 16:65889947-65889969 CGTCTCGTGGTCTCGTGGGGAGG + Intergenic
1154961043 18:21308981-21309003 TGTGCCTTCGTCTCTTTGGGTGG + Intronic
1160209025 18:76860601-76860623 TATGCCGTGGTCTCCTGGGTAGG + Intronic
1161686221 19:5703987-5704009 TGTGCCGCCGCCTCCTGTGGGGG - Intronic
1164828999 19:31306123-31306145 TGTGCCGTCGTCTCGTGGGGAGG - Intronic
1164855507 19:31517688-31517710 GATGCCGTGGTCTGGTGGGGAGG - Intergenic
926787493 2:16532475-16532497 TGTGCGGTGGCCTCGTGGGGTGG + Intergenic
931512295 2:63013518-63013540 TGTGCCTTTGTCTTTTGGGGGGG - Intronic
1168751509 20:285129-285151 TGTGCCTTCGTCTGGTGTTGTGG - Intronic
1172098224 20:32470939-32470961 AGTGCCCTCATCTCATGGGGAGG - Intronic
1176037572 20:63047539-63047561 TGTGCCGCCGTCTCATTGGTTGG + Intergenic
1179922050 21:44512680-44512702 TGTGCCCACGTTTCATGGGGTGG + Intronic
1179929058 21:44555371-44555393 TGTGCCGTCACCCCTTGGGGAGG - Intronic
1184060742 22:42079612-42079634 AGTGCCGGCGGCTCCTGGGGCGG - Intergenic
953574870 3:44104921-44104943 TGAGCAGTCGCCTCATGGGGGGG - Intergenic
1002211828 5:177604087-177604109 TGTGCAGCCTCCTCGTGGGGAGG + Intronic
1002322402 5:178383567-178383589 TGTCCCGTTGTTTCTTGGGGAGG + Intronic
1018962370 6:168457914-168457936 TGTGCCATCATCTTCTGGGGAGG + Intronic
1018970454 6:168525240-168525262 CGTGACGTCGTCTCCTGTGGTGG + Intronic
1019635829 7:2075096-2075118 GGTGCCGGCGTCTCGAGAGGAGG + Intronic
1019701673 7:2477297-2477319 TGTGCAGTGATCTCGTGGGTGGG + Intergenic
1029883352 7:103840086-103840108 TGTGCAGGCTTCTCCTGGGGAGG - Intronic
1036811106 8:11868131-11868153 TGCGCGGTGGTCACGTGGGGCGG - Exonic
1049587595 8:143439191-143439213 GGTGCCCAGGTCTCGTGGGGCGG + Intronic
1060117418 9:120953291-120953313 TGTACCGGCCTCTCCTGGGGAGG + Intronic
1185761811 X:2694144-2694166 TGTGCCGTTGCCCCGGGGGGTGG - Intronic
1187167342 X:16816375-16816397 TGAGACTTCGTCTCTTGGGGTGG - Intronic