ID: 1164829000

View in Genome Browser
Species Human (GRCh38)
Location 19:31306126-31306148
Sequence GGGTGTGCCGTCGTCTCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164829000_1164829005 -2 Left 1164829000 19:31306126-31306148 CCCCACGAGACGACGGCACACCC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1164829005 19:31306147-31306169 CCACCGTGTGCGCTCATTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1164829000_1164829007 0 Left 1164829000 19:31306126-31306148 CCCCACGAGACGACGGCACACCC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164829000_1164829006 -1 Left 1164829000 19:31306126-31306148 CCCCACGAGACGACGGCACACCC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1164829006 19:31306148-31306170 CACCGTGTGCGCTCATTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1164829000_1164829009 3 Left 1164829000 19:31306126-31306148 CCCCACGAGACGACGGCACACCC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1164829009 19:31306152-31306174 GTGTGCGCTCATTCCCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164829000 Original CRISPR GGGTGTGCCGTCGTCTCGTG GGG (reversed) Intronic
900532232 1:3160268-3160290 GGATGTGCCGTTGGCTGGTGTGG + Intronic
901449466 1:9327080-9327102 GCATCTGCCGTCGTTTCGTGGGG + Intronic
905389695 1:37628538-37628560 GGGTGTGGCATCTTCTCATGCGG + Intronic
917661539 1:177181713-177181735 GGGTGTGCCGGCGGCTGGCGGGG + Intronic
1068365125 10:56038115-56038137 GGGTGTGCTGTTATCTCTTGAGG + Intergenic
1073061286 10:100735352-100735374 GGGTGTGCCGGCGTCTAGGCTGG + Intergenic
1104922192 12:132296257-132296279 GGCTGTGCGGTCATCTCTTGGGG - Intronic
1124645989 15:31437832-31437854 GGGTGGGCCGTGGTCTCCTGTGG + Intergenic
1143201510 17:5116432-5116454 ATGTGAGCCGCCGTCTCGTGTGG + Exonic
1156579517 18:38358907-38358929 AGGTGTGCCATCATCTCCTGGGG + Intergenic
1160221921 18:76984328-76984350 GAGTGTCCCGTCGGCTCATGAGG - Intronic
1164829000 19:31306126-31306148 GGGTGTGCCGTCGTCTCGTGGGG - Intronic
1165992588 19:39825230-39825252 TGGTGTGGAGACGTCTCGTGGGG - Intergenic
934045672 2:88170833-88170855 AGGGGTGCCGTCGGCTCCTGGGG + Intronic
1175967640 20:62667526-62667548 GGGTGTGCCTTCCTTGCGTGAGG + Intronic
950107027 3:10394779-10394801 GGGTGTGTCGGGGTCTCGCGGGG + Intronic
968512739 4:1002698-1002720 GGGGGGGCCGTCGCCGCGTGGGG - Intronic
997792107 5:136770430-136770452 GGGTGTGCCCTCATCTCCTGAGG - Intergenic
1000618745 5:163459764-163459786 GGGTGTCCCGACGGCTCCTGTGG - Intronic
1057444003 9:95101137-95101159 GGGTGTGCTGTCTGCTCCTGTGG + Exonic
1062598201 9:137308473-137308495 GTGTGTGCCGTCATGTCCTGGGG + Intronic
1188074764 X:25761520-25761542 GGTTGTGCCTTCATCTGGTGTGG - Intergenic