ID: 1164829001

View in Genome Browser
Species Human (GRCh38)
Location 19:31306127-31306149
Sequence TGGGTGTGCCGTCGTCTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164829001_1164829006 -2 Left 1164829001 19:31306127-31306149 CCCACGAGACGACGGCACACCCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1164829006 19:31306148-31306170 CACCGTGTGCGCTCATTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1164829001_1164829009 2 Left 1164829001 19:31306127-31306149 CCCACGAGACGACGGCACACCCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1164829009 19:31306152-31306174 GTGTGCGCTCATTCCCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1164829001_1164829005 -3 Left 1164829001 19:31306127-31306149 CCCACGAGACGACGGCACACCCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1164829005 19:31306147-31306169 CCACCGTGTGCGCTCATTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1164829001_1164829007 -1 Left 1164829001 19:31306127-31306149 CCCACGAGACGACGGCACACCCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164829001 Original CRISPR TGGGTGTGCCGTCGTCTCGT GGG (reversed) Intronic
901449465 1:9327079-9327101 TGCATCTGCCGTCGTTTCGTGGG + Intronic
915109047 1:153551392-153551414 TGCCTGTGCCGTCCTCTCCTTGG + Intergenic
924415444 1:243851188-243851210 TTGGTCTGCCGTGGTCTCCTGGG - Intergenic
1068261931 10:54594415-54594437 TTGGTGTGCTGTCTTCTCTTTGG + Intronic
1106560924 13:30845689-30845711 AGGGTGTGCCTTCTTCTCTTAGG - Intergenic
1139570189 16:67806797-67806819 TCGGTGTCCCGACGTCTCGATGG - Intronic
1164829001 19:31306127-31306149 TGGGTGTGCCGTCGTCTCGTGGG - Intronic
1166023279 19:40053589-40053611 TGGGTGTGCAGGTGTCTCTTTGG - Intronic
932180855 2:69644326-69644348 TGGGTTTCCCGACGTCTCCTGGG + Intronic
934045671 2:88170832-88170854 TAGGGGTGCCGTCGGCTCCTGGG + Intronic
934051594 2:88215665-88215687 TGGGTGTCCAGTCCTCTCCTTGG + Intergenic
1176037571 20:63047535-63047557 TGGATGTGCCGCCGTCTCATTGG + Intergenic
1176146211 20:63566649-63566671 TGGGGGTGCCGTCTCCTTGTCGG - Intronic
965389978 3:168093460-168093482 TGTGTGTGCCTTGGTCTCTTAGG - Intronic
982685113 4:158479533-158479555 AGGGTTTGCCGTCTTCTTGTTGG + Intronic
992186818 5:74252207-74252229 TGGGTGTGGAGACGTCTGGTTGG + Intergenic
1006684943 6:35824888-35824910 TGGGTGTGCTGTTCTCTCATAGG + Intronic
1015287191 6:131499624-131499646 TGGGTGTGCAGGCATCTCTTTGG + Intergenic
1019701671 7:2477293-2477315 TGCGTGTGCAGTGATCTCGTGGG + Intergenic
1019820727 7:3240904-3240926 TGGGAGCGCCGTCGTGTCCTGGG + Intergenic
1033736707 7:144229470-144229492 TGTGTGTGCAGTCCTCTCTTAGG - Intergenic
1033746350 7:144321480-144321502 TGTGTGTGCAGTCCTCTCTTAGG + Intergenic
1062672436 9:137719427-137719449 TGGGTGTTGCGTCCTCTCCTAGG + Intronic