ID: 1164829002

View in Genome Browser
Species Human (GRCh38)
Location 19:31306128-31306150
Sequence GTGGGTGTGCCGTCGTCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164829002_1164829009 1 Left 1164829002 19:31306128-31306150 CCACGAGACGACGGCACACCCAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1164829009 19:31306152-31306174 GTGTGCGCTCATTCCCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1164829002_1164829005 -4 Left 1164829002 19:31306128-31306150 CCACGAGACGACGGCACACCCAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1164829005 19:31306147-31306169 CCACCGTGTGCGCTCATTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
1164829002_1164829006 -3 Left 1164829002 19:31306128-31306150 CCACGAGACGACGGCACACCCAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1164829006 19:31306148-31306170 CACCGTGTGCGCTCATTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1164829002_1164829007 -2 Left 1164829002 19:31306128-31306150 CCACGAGACGACGGCACACCCAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164829002 Original CRISPR GTGGGTGTGCCGTCGTCTCG TGG (reversed) Intronic
902476834 1:16692883-16692905 GGGGGTGCGCCGCCGTCTAGGGG + Intergenic
916991891 1:170253481-170253503 GTGGGTGTGCCATCATGTCTGGG + Intergenic
1065084973 10:22165051-22165073 GTGGATGTGCCGTGGTTTTGGGG - Intergenic
1078821837 11:14891130-14891152 GTGGGTGTCCCGACGTCCGGAGG - Intronic
1089500349 11:118928366-118928388 GTGGGTGTGCCAGCGCCACGAGG + Intronic
1202828099 11_KI270721v1_random:99507-99529 TTGGGTGGGCCGTCGTTTCTCGG - Intergenic
1100468983 12:94873617-94873639 GTGAGTGCGCCGTCGCCCCGGGG - Intergenic
1113902028 13:113802829-113802851 GTTGGTGTGCGGGCGTCTGGGGG - Intronic
1123005115 14:105317515-105317537 GTGGGTGTGAAGTGGTATCGTGG + Intronic
1132585304 16:703595-703617 GCGGGTGTGCCTGCGTCACGGGG - Intronic
1143059411 17:4187372-4187394 GTGGGTGTGCCGTGGAGTCCAGG - Intronic
1144903954 17:18625061-18625083 GCGGGTGCGCCGTCCTGTCGGGG - Intergenic
1148395589 17:47305422-47305444 GTGGGTGTGACTTCCTCTCCAGG + Intronic
1152427993 17:80229009-80229031 CTGGGTGTGCCTTCTTCTCTGGG - Intronic
1152905885 17:82970702-82970724 GTGGCTGTGCCCTGGTCACGTGG + Intronic
1153108780 18:1559794-1559816 GAGGGTGTGCTGAGGTCTCGGGG + Intergenic
1164829002 19:31306128-31306150 GTGGGTGTGCCGTCGTCTCGTGG - Intronic
1202710849 1_KI270714v1_random:18707-18729 GGGGGTGCGCCGCCGTCTAGGGG + Intergenic
931747124 2:65300279-65300301 GTGGGTGTGGTGGCCTCTCGGGG - Intergenic
932180854 2:69644325-69644347 GTGGGTTTCCCGACGTCTCCTGG + Intronic
950107025 3:10394777-10394799 GAGGGTGTGTCGGGGTCTCGCGG + Intronic
954304157 3:49716761-49716783 GAGGGTGTGCCGTCCTGTGGTGG + Intronic
961556893 3:127702038-127702060 GTGGCTGTGCAGTCATCTGGAGG + Intronic
962740419 3:138359248-138359270 GTGGGTGTGACGGCTTCTCAGGG - Intronic
977639810 4:99344375-99344397 GTGGGTGAGCCTTGGTTTCGAGG + Intronic
982068838 4:151677325-151677347 GTGGGTGTGAAGTCGTATCAGGG - Intronic
1002080674 5:176735532-176735554 GTGGGTGTGACATCTTCACGGGG + Intergenic
1007429874 6:41770656-41770678 CTGGCGGTGCCATCGTCTCGGGG + Exonic
1019701670 7:2477292-2477314 GTGCGTGTGCAGTGATCTCGTGG + Intergenic
1029711175 7:102300794-102300816 GTGGCTGGGCCGACGACTCGGGG + Exonic
1049425656 8:142536885-142536907 GTGGGGGGGCGGGCGTCTCGGGG - Intronic
1062366815 9:136213862-136213884 GTGTGTCTGCCTTCGTCTGGTGG - Intronic
1189615137 X:42775456-42775478 GTGGCTGAGCCGTTGTCTCATGG + Intergenic