ID: 1164829007

View in Genome Browser
Species Human (GRCh38)
Location 19:31306149-31306171
Sequence ACCGTGTGCGCTCATTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164829000_1164829007 0 Left 1164829000 19:31306126-31306148 CCCCACGAGACGACGGCACACCC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164829001_1164829007 -1 Left 1164829001 19:31306127-31306149 CCCACGAGACGACGGCACACCCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164829002_1164829007 -2 Left 1164829002 19:31306128-31306150 CCACGAGACGACGGCACACCCAC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164828998_1164829007 4 Left 1164828998 19:31306122-31306144 CCCTCCCCACGAGACGACGGCAC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1164828999_1164829007 3 Left 1164828999 19:31306123-31306145 CCTCCCCACGAGACGACGGCACA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164829007 Original CRISPR ACCGTGTGCGCTCATTCCCG GGG Intronic
901157231 1:7149011-7149033 GCCCTGTGGGCACATTCCCGAGG + Intronic
903298854 1:22363710-22363732 ACCCTGTCCGCTCTTTCCTGTGG - Intergenic
912517394 1:110224954-110224976 CCCGGGTCCACTCATTCCCGGGG + Intronic
1065917735 10:30366747-30366769 ACCATGTGCCCTCATGCCCAGGG - Intronic
1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG + Intronic
1090866348 11:130704137-130704159 TCCGTGTTCACTCATTCCCAAGG + Intronic
1091489058 12:917119-917141 ACTGTGTGTGCTCATTTCCGTGG - Intronic
1102098412 12:110258515-110258537 ACCGTGGGTGCTCACTCACGTGG - Intergenic
1103134861 12:118498542-118498564 TCCGTGTGTGCACATCCCCGGGG + Intergenic
1129038261 15:72664093-72664115 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129398776 15:75267946-75267968 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129402384 15:75292222-75292244 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129728750 15:77917413-77917435 ACCATGTGCCCTCATGCCCAGGG - Intergenic
1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG + Intergenic
1132956669 16:2598015-2598037 TCCGTGTGCCCTCGTTGCCGTGG + Exonic
1137247121 16:46714776-46714798 TCCGTGTGCCCTCATTCTCATGG - Intronic
1142979926 17:3665790-3665812 ACCCTGTGCGCTGGTCCCCGTGG - Intronic
1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG + Intronic
1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1166539525 19:43595998-43596020 ACCGACTGCGCTCTCTCCCGTGG - Exonic
937222530 2:120349940-120349962 ACCGTGTACCCCCGTTCCCGCGG - Exonic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG + Intronic
1179217692 21:39381265-39381287 ACGGAGGGCGCTCATTCTCGGGG - Intronic
962176164 3:133157843-133157865 ACCGGGGGAGCTCATTCCCCTGG - Intronic
997234468 5:132264829-132264851 ACCCTGTGCTCTCACTCCCAGGG + Intronic
997679317 5:135738209-135738231 ATCAAGTGCACTCATTCCCGTGG + Intergenic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1024457320 7:49624136-49624158 TCTGTGTGTGCTCATTCCTGAGG - Intergenic
1047062985 8:121248943-121248965 ACCGTGTGCACACATTCTCCTGG - Intergenic
1049188074 8:141269863-141269885 ACGGTGTCCGCTCATTCCTGGGG - Intronic
1061719309 9:132542059-132542081 ACCCTGTGAGCTCATGCCCAGGG + Intronic