ID: 1164831563

View in Genome Browser
Species Human (GRCh38)
Location 19:31325457-31325479
Sequence GTTGATGCATGGAGGCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164831558_1164831563 -9 Left 1164831558 19:31325443-31325465 CCGTATCCATTTTTGTTGATGCA No data
Right 1164831563 19:31325457-31325479 GTTGATGCATGGAGGCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164831563 Original CRISPR GTTGATGCATGGAGGCTTCT GGG Intronic
900380187 1:2380087-2380109 GCTCCAGCATGGAGGCTTCTGGG + Intronic
900715596 1:4141537-4141559 GCTGATGGATGAAGGTTTCTCGG - Intergenic
902724744 1:18327310-18327332 GTGGCTGCATGATGGCTTCTTGG - Intronic
903807056 1:26013068-26013090 GTTAATGCATGGAGCCAGCTTGG - Intergenic
904348973 1:29892727-29892749 GATGATCAAGGGAGGCTTCTGGG - Intergenic
905111377 1:35597203-35597225 GTTGAGGCATTGCAGCTTCTTGG - Intergenic
905707975 1:40076489-40076511 CATCATGCATGGAGGCTTCCTGG + Intronic
909574804 1:77161656-77161678 GTTCATACATGGATGCTCCTTGG + Exonic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
920665819 1:207962524-207962546 GTAGAAGCATAGAGTCTTCTAGG + Intergenic
1067527405 10:47046885-47046907 GTTGGGGCATGGGTGCTTCTGGG + Intergenic
1072241563 10:93499893-93499915 AAAGATGGATGGAGGCTTCTGGG - Intronic
1077106389 11:844240-844262 GTGGGGGCCTGGAGGCTTCTTGG + Intronic
1083631777 11:64099202-64099224 GGTGGATCATGGAGGCTTCTTGG - Intronic
1085804277 11:79620215-79620237 GTTGATTTATGGTGGCTGCTTGG + Intergenic
1086074580 11:82836429-82836451 GTTGATGAAAGGAGTTTTCTTGG - Intronic
1088542877 11:110931406-110931428 GCTGATCCATGGAGGGTTTTGGG - Intergenic
1089085028 11:115809687-115809709 GCTGATGCAGCCAGGCTTCTGGG + Intergenic
1089188321 11:116636199-116636221 AGTGAAGTATGGAGGCTTCTTGG + Intergenic
1089557759 11:119324166-119324188 GGTGATGAAAGAAGGCTTCTTGG + Intergenic
1091855688 12:3737536-3737558 GTGGATACATGGAGGCTGGTTGG + Intronic
1091986443 12:4913009-4913031 GTTGTTGCATTGAGGATTTTGGG + Exonic
1092081876 12:5723294-5723316 GCTGCTGCTTGGAGGCTGCTAGG + Intronic
1100211638 12:92404917-92404939 GTTGGTACACTGAGGCTTCTGGG + Intergenic
1102910039 12:116706645-116706667 GTTGATGCAAGTAAGCTTCCTGG - Intergenic
1105510818 13:21050357-21050379 GTGGGGGCCTGGAGGCTTCTGGG - Intronic
1105678697 13:22703939-22703961 GTGGACGCCTGGAGGCTTCAGGG - Intergenic
1116826377 14:49677169-49677191 GGTGATGCATGTTTGCTTCTTGG - Intronic
1121059340 14:90890568-90890590 GGTGAAGCATGGAGTCTTCAGGG + Exonic
1121736507 14:96221660-96221682 GTTGGTGCAAGGGGGCTTGTGGG + Intronic
1123701625 15:22918402-22918424 GTTCATGCATGGTGCCTTATGGG - Intronic
1129586666 15:76874615-76874637 TTTGATGTGTGGAGGTTTCTAGG - Intronic
1131393198 15:92066133-92066155 GTTAATGCTTGGAGGCTGTTTGG - Intronic
1131506574 15:93025101-93025123 ACTGGTGCATGGAGGCTGCTGGG + Exonic
1133609323 16:7418198-7418220 TATGGGGCATGGAGGCTTCTGGG - Intronic
1137958836 16:52861340-52861362 GATGATAAATGGAGGCTTCCTGG - Intergenic
1138416280 16:56873143-56873165 CTTGCTGCAGGCAGGCTTCTTGG + Intronic
1140141474 16:72262174-72262196 GTTGAAGTATGGAGGCCACTGGG - Intergenic
1141154082 16:81584866-81584888 GTTGACTCATGGAGGCATCCAGG - Intronic
1143451038 17:7036773-7036795 GGTGATGACTGGAGGCATCTTGG + Exonic
1147551247 17:41443571-41443593 GAAGATGCAGGGAGGCATCTAGG + Intergenic
1147868106 17:43567239-43567261 GGAGACACATGGAGGCTTCTGGG + Intronic
1152358267 17:79816976-79816998 GGTGATGCATGGGACCTTCTCGG - Intergenic
1152371857 17:79893196-79893218 GCTGATGCATGGAGGGTGCTTGG + Intergenic
1152517496 17:80834392-80834414 GACGATGCACGGAGGCTGCTCGG - Intronic
1152536135 17:80951218-80951240 GTGGATGTGTGGATGCTTCTGGG - Intronic
1152554522 17:81046242-81046264 GGGGATGCATGGAAGTTTCTGGG - Intronic
1156086239 18:33407163-33407185 GTTGAAGCAGGGAGACATCTGGG - Intronic
1156470190 18:37372972-37372994 GTTGTTGAATGGAGTCTTCTTGG - Intronic
1156624649 18:38893680-38893702 GGTGAGGCATGGAGGCTGATGGG + Intergenic
1160956845 19:1697537-1697559 TTTGAGGCATGGGGCCTTCTAGG - Intergenic
1164831563 19:31325457-31325479 GTTGATGCATGGAGGCTTCTGGG + Intronic
1165145950 19:33730304-33730326 GTTGAAGCAGGGAGACCTCTTGG + Intronic
1165211241 19:34237521-34237543 GTGGATGAATGGATGCTTTTAGG - Intergenic
1165548033 19:36558562-36558584 GTTGATGGATTTAGGATTCTGGG - Intronic
926796176 2:16620945-16620967 GTGGAACCATGGAAGCTTCTTGG - Intronic
929193349 2:39161056-39161078 GTTGCTAGATGGAGCCTTCTTGG + Intergenic
929245758 2:39701308-39701330 TTTGATGCATATAGGATTCTTGG + Intronic
930196962 2:48519918-48519940 GATAATACATGGAGGCTTTTTGG + Intergenic
931289924 2:60863462-60863484 GCTGATGGATGGAGCTTTCTGGG - Intergenic
934558000 2:95297497-95297519 GGGGAGGAATGGAGGCTTCTGGG + Intronic
934967476 2:98735277-98735299 GTTAATGCATGGAGGGGGCTGGG - Intergenic
942312527 2:174668745-174668767 TTTGTTGCATGCATGCTTCTGGG - Intronic
942726871 2:179019248-179019270 GTTGATTCCTGGAGTCTTCAGGG - Intronic
942804497 2:179913939-179913961 CAAGATGCATGGAGCCTTCTTGG - Intergenic
944606871 2:201359713-201359735 GTTGATGGAGGGAAGCGTCTTGG + Intergenic
948218452 2:236250203-236250225 ATTAATCCTTGGAGGCTTCTGGG - Intronic
1168764149 20:370567-370589 GTGGATGGATGGATGCTTGTCGG + Intronic
1168813558 20:721609-721631 GTGCATGCAGGGAGGCTTCCTGG + Intergenic
1168925264 20:1574135-1574157 GCTGAGGGAGGGAGGCTTCTGGG + Intronic
1168929142 20:1607163-1607185 GCTGAGGGAGGGAGGCTTCTGGG + Intronic
1168936953 20:1673820-1673842 GTGGAGGCAGGGAGGCTCCTGGG + Intergenic
1168969271 20:1919639-1919661 GTCGAGGCAGGGAGGGTTCTGGG - Intronic
1172742996 20:37183966-37183988 TTAGATGCTTGGAGGCTGCTGGG + Intronic
1174736186 20:52968222-52968244 GGTCATGGGTGGAGGCTTCTCGG + Intergenic
1175481612 20:59315143-59315165 GTTGATGAGTGGTGCCTTCTAGG + Intronic
1177029377 21:15963233-15963255 GTTGATGCATTGAGAATTTTAGG + Intergenic
1179162255 21:38908291-38908313 GATGATACTTGGAGTCTTCTCGG - Intergenic
1179280093 21:39926534-39926556 GTTGATGCAAGGATTCCTCTGGG + Intronic
1183289434 22:36990591-36990613 GTGGATGCGTGCAGCCTTCTGGG - Intergenic
1184302430 22:43569527-43569549 GTGGATGCATGGAGTCTGCCTGG + Intronic
1184441577 22:44519874-44519896 GGTGATGCTTGGTGGCTCCTGGG - Intergenic
1184744646 22:46449240-46449262 GTTGATGCATGATGGGTTGTTGG - Intronic
950052440 3:10002847-10002869 GTTGAGCCAGGGAGGTTTCTGGG - Intronic
951732010 3:25820401-25820423 GTTAATGCAAGGATGCTCCTTGG - Intergenic
953889483 3:46741860-46741882 GTTGAAACATGCAGGCTTTTAGG - Intronic
955268255 3:57468957-57468979 GTGGATGGATGGAGGGTTTTTGG - Intronic
956526562 3:70169541-70169563 GTTGCTGCATGAAAGCTTCATGG + Intergenic
958270139 3:91489576-91489598 TTTGATGAATGGAGGCTTGGAGG + Intergenic
959598370 3:108152161-108152183 GTGGAAGCAGAGAGGCTTCTGGG + Intergenic
961078215 3:124001371-124001393 GTTCAGGCATGGAGGCATCACGG - Intergenic
961823668 3:129587839-129587861 GTTGGTGTGTAGAGGCTTCTGGG - Intronic
962297216 3:134201644-134201666 GAAAATGCATGGAGGCTTGTGGG + Intronic
964633420 3:158836490-158836512 AGTGATCCAGGGAGGCTTCTCGG + Intergenic
964711036 3:159671887-159671909 GGAAATACATGGAGGCTTCTGGG - Intronic
966902814 3:184499483-184499505 GCTGCTGGATGGAGGCGTCTAGG - Intronic
967738322 3:192978034-192978056 GTAGATGTATGGATGTTTCTGGG - Intergenic
968959594 4:3736330-3736352 GGGGATGCGGGGAGGCTTCTGGG - Intergenic
970669797 4:18383143-18383165 GTTAATGAATGGGGGCTTCTGGG + Intergenic
975598726 4:76076524-76076546 GTTGGTGTATACAGGCTTCTTGG + Intronic
979263170 4:118671529-118671551 GGTGATGAGTGAAGGCTTCTTGG + Intergenic
979986308 4:127319977-127319999 GTTTATGCATGTTGGTTTCTGGG - Intergenic
980342013 4:131562839-131562861 GTTCTTGGATGGTGGCTTCTTGG - Intergenic
982061198 4:151605771-151605793 GTTGATGGATGGAAGTTTTTTGG + Intronic
985941809 5:3142308-3142330 CTTGATGAATGGAGGCTCCAGGG + Intergenic
986596609 5:9429323-9429345 GTTGATGGATGGATTTTTCTGGG - Intronic
986967019 5:13286313-13286335 TTTGATGGATGTAGTCTTCTTGG + Intergenic
988695810 5:33621722-33621744 ATTGATGTGTGGAGGCTCCTGGG + Intronic
992345855 5:75877428-75877450 GTTGTTGCATGGAGTGTTGTAGG - Intergenic
1009173057 6:60424718-60424740 TTTGATGAATGGAGGCTTGGAGG - Intergenic
1011134387 6:84084671-84084693 GTTAATACATAGAGCCTTCTAGG - Intronic
1012166241 6:95956219-95956241 GTTCATATATGGAGACTTCTGGG + Intergenic
1016988604 6:149913321-149913343 GGATTTGCATGGAGGCTTCTTGG + Intergenic
1016991823 6:149935405-149935427 GAAGTTGCATGGAGGTTTCTTGG - Intergenic
1017007912 6:150041214-150041236 GGAGTTGCATGGAGGCTTCTCGG + Intergenic
1017121869 6:151031498-151031520 GTTCATCCATGAAGGCTTCGTGG + Intronic
1018584097 6:165336207-165336229 GTTTTTGCATGGAGGCAGCTTGG - Exonic
1018901492 6:168054024-168054046 GTTGAAGCATGGACTCCTCTGGG - Intergenic
1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG + Intergenic
1019628191 7:2032099-2032121 GCTGATGCATGGAAACTCCTTGG - Intronic
1020835536 7:13145812-13145834 GTTGATCAATGGAGGCTAATGGG - Intergenic
1023282216 7:38582446-38582468 GTTGATGCATGGAAAGCTCTTGG - Intronic
1023921266 7:44631997-44632019 GATGATGGATGCAGGCTTCAGGG + Intronic
1024283796 7:47739810-47739832 TTTGATACATGGTGGCTCCTGGG + Intronic
1031898306 7:127380095-127380117 GTTGATTATTGAAGGCTTCTTGG - Intronic
1032520947 7:132544579-132544601 GGTGATCCATGGGGGCTTCTAGG + Intronic
1034129611 7:148702890-148702912 GTTGATGCATGCAGTATGCTAGG - Intronic
1036045741 8:5137827-5137849 TTTTATGTATGGAGGCTTCATGG + Intergenic
1037874323 8:22532866-22532888 GTTGCTGAATGGAGAGTTCTCGG + Intronic
1040287246 8:46106726-46106748 GGTGAGCCCTGGAGGCTTCTGGG + Intergenic
1040339626 8:46433925-46433947 GGAGAGCCATGGAGGCTTCTTGG - Intergenic
1042738566 8:72017076-72017098 CTTGATGCTTGGAGGTTTATCGG + Intronic
1045203423 8:100011051-100011073 GTCAATGCATGGAGGCCTATGGG + Intronic
1045387633 8:101686876-101686898 CTTGAGGCATGCAGTCTTCTGGG + Exonic
1045870221 8:106918111-106918133 TTTGCTGGATGGAGGTTTCTGGG + Intergenic
1046542716 8:115607062-115607084 GATGATGCCTGGTGGTTTCTTGG - Intronic
1048468862 8:134689429-134689451 GTTGATGCAGGGCAGGTTCTTGG - Intronic
1051360567 9:16278124-16278146 GCTGATACATGCAGGCCTCTCGG + Intergenic
1051830078 9:21266222-21266244 GTCGAAGCATGGGGGCTTCCAGG - Intergenic
1057828279 9:98387946-98387968 GTTCATGCAATGTGGCTTCTGGG + Intronic
1059430307 9:114245980-114246002 GGTGGTGCATGGAGGGTGCTGGG - Intronic
1060282530 9:122223986-122224008 GATGATGCTTGGGGGCTCCTTGG - Intronic
1060832156 9:126723323-126723345 GGTGATGGATGGAGCCTTCAGGG + Intergenic
1061603367 9:131687984-131688006 GCTCATGGATGGAGGCTTCCCGG + Intronic
1185851295 X:3491127-3491149 GCTGGTGCATGTAGCCTTCTTGG + Intergenic
1196890167 X:120283791-120283813 GTTGAGGAATGGAGGCAGCTAGG - Intronic
1198807250 X:140504491-140504513 GTCGATGAATGGTCGCTTCTCGG + Exonic