ID: 1164832847

View in Genome Browser
Species Human (GRCh38)
Location 19:31335835-31335857
Sequence CCTTCTGTAATGAATGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164832847_1164832856 29 Left 1164832847 19:31335835-31335857 CCAAGTGCATTCATTACAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 130
Right 1164832856 19:31335887-31335909 TGAGATTCCTCTGGGACTCTTGG 0: 1
1: 0
2: 4
3: 16
4: 213
1164832847_1164832850 -4 Left 1164832847 19:31335835-31335857 CCAAGTGCATTCATTACAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 130
Right 1164832850 19:31335854-31335876 AAGGTGGACGTCACACCATGAGG 0: 1
1: 0
2: 0
3: 11
4: 380
1164832847_1164832853 21 Left 1164832847 19:31335835-31335857 CCAAGTGCATTCATTACAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 130
Right 1164832853 19:31335879-31335901 CAGCCACCTGAGATTCCTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 193
1164832847_1164832852 20 Left 1164832847 19:31335835-31335857 CCAAGTGCATTCATTACAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 130
Right 1164832852 19:31335878-31335900 GCAGCCACCTGAGATTCCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164832847 Original CRISPR CCTTCTGTAATGAATGCACT TGG (reversed) Intronic
900857078 1:5194887-5194909 TCTTCTGTCATGAATTCACTTGG - Intergenic
901907721 1:12428694-12428716 CCTGCTGTAATGGAAGCACACGG - Intronic
906372407 1:45265499-45265521 CCTTCTGTAAAATATGCACCAGG + Intronic
909141615 1:71874113-71874135 TCTTCTGCAATTAATTCACTTGG + Intronic
910368534 1:86491582-86491604 ACTTCTGTGAGGAATTCACTTGG - Intronic
910594741 1:88968259-88968281 CCTTCTGTAATGAAATGCCTAGG - Intronic
910743560 1:90548395-90548417 CCTTATGTAATGTAGGCACTTGG - Intergenic
915499203 1:156302852-156302874 TGTTCTGTTATCAATGCACTTGG + Intergenic
916741622 1:167651387-167651409 CCTTCTGTCATGCCTGCCCTGGG + Intronic
917351349 1:174081262-174081284 CTTTTTGTGATGAATGTACTGGG - Intergenic
917601708 1:176581222-176581244 CCTTCCGCAATCAATGTACTTGG + Intronic
918443210 1:184589449-184589471 CCTTCTGTTGTGAGTGCATTCGG + Intronic
923440037 1:234008796-234008818 CCTTCTGTCATGACTGTTCTTGG + Intronic
923584833 1:235259246-235259268 TCCTGTGTAATGAATGAACTAGG - Intronic
1063906970 10:10790865-10790887 CTTTCTGTAAGGAATTCAGTAGG + Intergenic
1070444748 10:76486319-76486341 CCTTGACTAATGCATGCACTGGG - Intronic
1070496399 10:77027976-77027998 CCCTCGGTAATGACTGCATTAGG - Intronic
1071060256 10:81561700-81561722 CCAACTGTAAAGCATGCACTTGG + Intergenic
1071270870 10:84006221-84006243 CCTTCTGAAAGGAATGCTCTGGG - Intergenic
1078630002 11:12993799-12993821 ACTTCTGTATGGAATGTACTGGG - Intergenic
1080662959 11:34312297-34312319 CCCTCTGAAATGAATGAACAAGG - Intronic
1082944703 11:58745830-58745852 CCTTCTGTTATCAATGGAGTAGG + Intergenic
1084631322 11:70353126-70353148 CATTTTGCATTGAATGCACTTGG + Intronic
1085422601 11:76376541-76376563 CCATCTGTCAGGAATGCACAGGG + Intronic
1086266938 11:85011177-85011199 CATTCTGCAATGAATAGACTTGG + Intronic
1089951051 11:122526622-122526644 TATTCAGTAATGAATGAACTAGG + Intergenic
1090896212 11:130977483-130977505 CATTCTGCATTGACTGCACTGGG + Intergenic
1091639712 12:2226866-2226888 TCTTTTCTAATGAATGCGCTGGG + Intronic
1092493433 12:8967908-8967930 CTTTCTGTTATGATTGCTCTAGG - Intronic
1096860108 12:54520140-54520162 CCTTCTGTAAGCAATGTAGTTGG + Intronic
1097339920 12:58426181-58426203 CCTTCTGTGTTGATTTCACTGGG - Intergenic
1103539609 12:121656819-121656841 CCTTCTGTCCTGAATTCTCTAGG + Intronic
1104435456 12:128752798-128752820 CATTCTGTAATGGATGCACGTGG - Intergenic
1105938571 13:25126222-25126244 ATTTCTGTAAAGAATGCTCTTGG - Intergenic
1106327695 13:28710061-28710083 CCCTTTGTAATGAATGATCTAGG + Intronic
1106412774 13:29522711-29522733 CCATCTGTAAAGACTGTACTGGG - Intronic
1106893483 13:34271902-34271924 ACTGCTGCAGTGAATGCACTAGG + Intergenic
1107452584 13:40523861-40523883 CCTTCTACAACGAAAGCACTAGG + Intergenic
1109219962 13:59631216-59631238 CCTTCTGAAATGAAGGCAGGTGG + Intergenic
1110488547 13:76074597-76074619 CCTTTTGAAATGAATGTAATTGG + Intergenic
1112133485 13:96549917-96549939 CCTTCTGGCAATAATGCACTAGG + Intronic
1112448414 13:99488215-99488237 CCTTCTGCAGTGAAAGTACTAGG - Intergenic
1115893073 14:38054000-38054022 GCTTCTGAAATGACTGCACTTGG + Intergenic
1116184586 14:41581350-41581372 CCTTGTCAAATGAAAGCACTTGG + Intergenic
1116391679 14:44399167-44399189 CTTTTTGTAATGTATGCTCTTGG - Intergenic
1119444351 14:74650941-74650963 CCTTCTGTAATATATTCATTTGG - Intergenic
1121406730 14:93723577-93723599 CCACCTGGAATGAGTGCACTTGG - Intronic
1121584048 14:95050770-95050792 CCTGCTGTACTGCATTCACTCGG + Intergenic
1126728173 15:51654313-51654335 CCTTCTCTATTGAATGGACTTGG + Intergenic
1130716904 15:86343693-86343715 TCTTCTTAAATGAATTCACTGGG + Intronic
1135380281 16:21990345-21990367 CCTTCTCTGATGCATGCACTGGG + Intronic
1140919426 16:79523274-79523296 CCTTCTGTAACTAATTCTCTAGG + Intergenic
1148807370 17:50270746-50270768 CATTCTTTAGTGAATGCACTGGG + Intergenic
1149562825 17:57620936-57620958 CCCTCTGTAAAGCATCCACTGGG + Intronic
1149877239 17:60247593-60247615 CTTTCTCTAATGTATGCTCTTGG + Intronic
1150545670 17:66155136-66155158 CCTTCTGCATTGATTTCACTGGG - Intronic
1155728823 18:29126235-29126257 CCTCCTGTAATGCATGCTCTGGG - Intergenic
1158300470 18:56046645-56046667 CCTTCAGTGAAGTATGCACTGGG - Intergenic
1158554353 18:58463089-58463111 TCTTCTGTAAGGAATGCTCCTGG + Intergenic
1163168973 19:15517573-15517595 TCTTCTGGAATGAATGAAATGGG - Intronic
1163982374 19:20913177-20913199 CCTCCTGTAATGAATGAGTTGGG - Intergenic
1164832847 19:31335835-31335857 CCTTCTGTAATGAATGCACTTGG - Intronic
1168635753 19:57995396-57995418 ACTTCTCTAATGGATACACTCGG + Intronic
925704193 2:6668598-6668620 CCTTCTGTGATGGATGGAGTTGG - Intergenic
927644889 2:24871415-24871437 CCTTCTGTAAGGAATGAGATTGG + Intronic
928973537 2:37058534-37058556 CCATCTGTAATGAAAGCCCATGG - Exonic
933517776 2:83328036-83328058 ACTTTTGGAATGAATGCACACGG + Intergenic
933645463 2:84809557-84809579 CCTTCTATATTGAATGAATTGGG + Intronic
935251830 2:101269307-101269329 CATTCTGTATTGAATTCAGTAGG + Exonic
937255945 2:120555673-120555695 CCTCCTGGAATGCATGCACATGG - Intergenic
938112048 2:128574517-128574539 CCTCCTTTATTGAATTCACTTGG - Intergenic
939881122 2:147632554-147632576 CCTCCTGAATTGGATGCACTAGG - Intergenic
940051414 2:149469115-149469137 CCTCCTGTGATGAATGAACTGGG - Intronic
941493098 2:166166775-166166797 CCTTCTGGAATGAACAAACTTGG - Intergenic
942547073 2:177076301-177076323 CCTCCTCTAATGCTTGCACTTGG + Intergenic
947367390 2:229410704-229410726 ACTTCTGTAAAGAATGCTGTTGG - Intronic
1170410597 20:16086648-16086670 CTTTCTCTAATGAATGTTCTTGG - Intergenic
1175104540 20:56605211-56605233 CCATCTGTAATCATAGCACTTGG + Intergenic
1177657728 21:24041140-24041162 CCTTCTGCCATGATTACACTGGG - Intergenic
1183021595 22:35031341-35031363 CCTTCTGCATTGATTTCACTGGG + Intergenic
952414352 3:33076919-33076941 CCTTCTGTATTTAATTAACTGGG - Intronic
952861853 3:37819514-37819536 CCTCATGTAATGAATCCACCAGG + Exonic
953114613 3:39979717-39979739 CCTTTTGTCATGCATTCACTGGG + Intronic
956186768 3:66570101-66570123 CCTTCTCTAATGGAAGCATTTGG - Intergenic
958845381 3:99259527-99259549 ACTTCTGCAGTGAAAGCACTGGG - Intergenic
962599756 3:136982800-136982822 CCTTCTGTAATGACTTCTGTGGG + Intronic
963564081 3:146905830-146905852 CATTCTGTACTGAATCCATTGGG + Intergenic
969697475 4:8742858-8742880 CCCTGGGTCATGAATGCACTGGG + Intergenic
973271233 4:48264986-48265008 CCTTGTGTAACTAATGCCCTTGG - Intronic
975951551 4:79778010-79778032 CTTTCTGTAATGAATGCTATTGG - Intergenic
981032039 4:140135445-140135467 CCCTCTGTAATGTAGCCACTGGG + Intronic
981481582 4:145243892-145243914 CCTTCTGTATTGATCTCACTGGG + Intergenic
982878580 4:160679520-160679542 TCTTATGAAATAAATGCACTTGG - Intergenic
983554929 4:169051433-169051455 GGTTCTGGAATGACTGCACTGGG + Intergenic
985728371 5:1527386-1527408 CCTTGTGTTCTCAATGCACTTGG - Intergenic
987685037 5:21186165-21186187 CCTTATGTCATAACTGCACTTGG - Intergenic
987919441 5:24259536-24259558 CCTTCTGCAATACATGAACTTGG + Intergenic
990108843 5:52297547-52297569 CCTACTGTACTGAATACTCTAGG + Intergenic
992292530 5:75293644-75293666 CCTTCTGCATTGATTTCACTGGG + Intergenic
993541526 5:89158922-89158944 CCTTCTGCATTGATTTCACTGGG - Intergenic
997544905 5:134697969-134697991 CCTTCTGTAATTTCTGTACTTGG - Exonic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000044398 5:157509969-157509991 TCTTCTGTAATCAGTGCCCTTGG + Intronic
1001194034 5:169655376-169655398 CCTCCTCTAATGGATTCACTGGG - Intronic
1001794580 5:174491424-174491446 CCTTTTGCAATGAATGCAATGGG - Intergenic
1002994006 6:2265511-2265533 CCTTCTCTAATGAAATGACTCGG - Intergenic
1004774008 6:18821951-18821973 CCTTCTATATTGAATGCAGATGG + Intergenic
1008896941 6:56566593-56566615 CCTTCTGCATTGATTTCACTGGG + Intronic
1009278662 6:61719053-61719075 CCTTCTGTGGAGAATGTACTAGG - Intronic
1009721384 6:67475045-67475067 CCATCTGGATTGAATGCATTAGG - Intergenic
1010481301 6:76357367-76357389 CCCTCTGTAATGGATGTGCTGGG - Intergenic
1011766168 6:90622859-90622881 CCTTCTGCATTGATTTCACTGGG - Intergenic
1015622316 6:135144096-135144118 CTTTCTGTAAAGAATCCATTAGG + Intergenic
1020562889 7:9753539-9753561 CCTTCTAAAATGAATGCTATTGG - Intergenic
1021597698 7:22334856-22334878 CCTTCTCTGAAGAATGCTCTTGG + Intronic
1023889708 7:44383431-44383453 CCATCTGGTCTGAATGCACTGGG - Exonic
1023949550 7:44831821-44831843 ACTTTTGTAATGAATGGAGTGGG + Intronic
1024931671 7:54670855-54670877 CATCCTGTAATCTATGCACTGGG - Intergenic
1026208035 7:68276123-68276145 CCCTCTTCAAGGAATGCACTAGG + Intergenic
1028076369 7:86521142-86521164 CTATCTGTAAGGAATACACTTGG - Intergenic
1028683424 7:93565242-93565264 TCCTCTTTAATGAATGCACTGGG + Intronic
1029505982 7:100964547-100964569 CCTTCTGAAAAGGATGCACGTGG + Intronic
1030888634 7:114970142-114970164 CCTTCAGTAACAAATCCACTGGG - Intronic
1034735282 7:153423509-153423531 ATTTGTGTAATGAATGCACTGGG + Intergenic
1035472373 7:159118666-159118688 CTTTCTATAATGAAAGAACTTGG - Intronic
1036494819 8:9260674-9260696 CCTTCTCTAATGGAGACACTGGG + Intergenic
1039185561 8:34911606-34911628 CCTTCTGTAAGGACTGAAATGGG + Intergenic
1040395240 8:46992526-46992548 CCTTCTGCACTGAGTGCCCTGGG - Intergenic
1042890218 8:73601619-73601641 AATACTGTAATGAATCCACTGGG + Intronic
1045123885 8:99068317-99068339 CCTTTTATAATGAAATCACTAGG + Intronic
1045246180 8:100443457-100443479 CCTTCTCTAATGCTTGCAGTTGG + Intergenic
1046584992 8:116140278-116140300 CCTTCTCTGAAGAATGCACTTGG - Intergenic
1046760638 8:118016450-118016472 CCTTGGGAAATGAATGCAGTAGG + Intronic
1047567739 8:126063842-126063864 CCTACTTTAATGAATGCATTGGG + Intergenic
1048422681 8:134292852-134292874 CCTCCTGGAATGGAGGCACTTGG - Intergenic
1048908002 8:139106874-139106896 CCTTCAGTAGTGAAGGCACATGG - Intergenic
1059935025 9:119301294-119301316 CCTTAAGTAATAAATCCACTGGG - Intronic
1061700846 9:132414459-132414481 CCTGCTGTAAGGAAAGCTCTTGG + Intronic
1186126595 X:6420899-6420921 CATTCTGTCTTGAATGCAGTAGG + Intergenic
1189685816 X:43562596-43562618 CCTTTGGTAATGAGGGCACTGGG + Intergenic
1190296329 X:49029932-49029954 CCTTCTGAAATACCTGCACTGGG + Exonic
1193713899 X:84913945-84913967 CTTTCTGTAATGACTGAACTGGG - Intergenic
1196133293 X:112180925-112180947 CCTTCTGTGTTGATTTCACTGGG - Intergenic
1197493026 X:127142183-127142205 TATGCTGTAATGAATGCCCTTGG - Intergenic
1197558173 X:127983361-127983383 CCTTCTGTAATCCAAGCATTTGG + Intergenic
1197868417 X:131042722-131042744 CCTTCTCTGATGCGTGCACTGGG - Intergenic
1199427586 X:147720817-147720839 CTTTATGTAAGGAATACACTCGG + Intergenic
1200388603 X:155918703-155918725 CCTTCTGCATTGATTTCACTGGG + Intronic