ID: 1164833574

View in Genome Browser
Species Human (GRCh38)
Location 19:31341373-31341395
Sequence GTAGGTGCACAGAGGCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164833569_1164833574 -1 Left 1164833569 19:31341351-31341373 CCTGTGGTGGTCTGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 211
1164833565_1164833574 8 Left 1164833565 19:31341342-31341364 CCCTGATGTCCTGTGGTGGTCTG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 211
1164833566_1164833574 7 Left 1164833566 19:31341343-31341365 CCTGATGTCCTGTGGTGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164833574 Original CRISPR GTAGGTGCACAGAGGCCTGA TGG Intronic
900327089 1:2113737-2113759 GTTGGGGCACAGAGGACTCATGG + Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
901792555 1:11661953-11661975 TTAGGTTCCCAGAGGACTGAGGG + Exonic
902706389 1:18208176-18208198 GAAGGGGCCCAGAGGCCTGGTGG + Intronic
903028177 1:20444329-20444351 GGAGGTGAACAAAGACCTGAAGG + Intergenic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
908120672 1:60983398-60983420 GAAGATGCACACAGGCCTGCGGG - Intronic
908234593 1:62137565-62137587 GAGGGGGGACAGAGGCCTGAGGG + Intronic
908234613 1:62137619-62137641 GAGGGGGGACAGAGGCCTGAGGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912948289 1:114102948-114102970 GCAGCTGCACAGAGACCTGCAGG - Intronic
916586718 1:166155850-166155872 GTAGGGGAAGAGAGGCGTGAAGG - Intronic
916803593 1:168237301-168237323 GTATGTGCTCAGAGGCTTGTTGG + Intronic
919516555 1:198532663-198532685 ATATGTGAACAGAGGCCTAAAGG + Intronic
920805022 1:209224865-209224887 GTTGGAGCACAGAGGGCAGAGGG - Intergenic
921958708 1:221011649-221011671 GTGGGAGCACAGAGGCTTGCAGG + Intergenic
922462560 1:225824564-225824586 GAAGGAGCTCGGAGGCCTGATGG - Intronic
924508256 1:244706327-244706349 GAAGGAGCACACAGCCCTGAGGG + Exonic
924572187 1:245247031-245247053 GTAAGTGCAGAGGGGCCAGAGGG + Intronic
924801162 1:247330691-247330713 TAAGGATCACAGAGGCCTGATGG - Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063710237 10:8470139-8470161 GTAGGTAAACTGAGTCCTGAGGG - Intergenic
1063987935 10:11527097-11527119 GCAGGTGTACAGAGTGCTGAGGG + Intronic
1064133008 10:12726920-12726942 CTGGGAGCACAGGGGCCTGAGGG - Intronic
1066330506 10:34416547-34416569 GTAGGTGCAAAGATGCCTGAGGG - Intronic
1067035868 10:42916096-42916118 GTTGCTGCCCAGAGGGCTGAAGG - Intergenic
1067355572 10:45522271-45522293 GGAGGGCCACTGAGGCCTGAAGG + Intronic
1069128050 10:64662711-64662733 GTAGGTACAGAGAGGCTTAATGG - Intergenic
1070781202 10:79138329-79138351 GTGGGTCCACAGAGGCCAGAAGG - Intronic
1074558178 10:114510983-114511005 GTAGGAGCACAGAGGAGGGAGGG - Intronic
1076836859 10:133025548-133025570 GCAGGTGCACAGCGGCCAGTGGG + Intergenic
1077000437 11:319564-319586 AGAGATGCACAGAGGCCGGAAGG + Intergenic
1077020363 11:414440-414462 GCAGGTGCACATGGGCCAGAGGG - Intronic
1077052117 11:571623-571645 GTATGTGCACACGGACCTGATGG + Intergenic
1077848045 11:6046567-6046589 GCAGGTGCAGAGAGGCCTCCAGG + Intergenic
1082645321 11:55716803-55716825 GTAGATACACAGAGGAATGAAGG + Intergenic
1083408442 11:62474846-62474868 GTAGCTTTTCAGAGGCCTGAAGG - Intronic
1084315626 11:68343735-68343757 GAAGCAGCACTGAGGCCTGAGGG - Intronic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1084693091 11:70738325-70738347 GTTGGTGCACAGAAGACAGAGGG - Intronic
1087078993 11:94151894-94151916 GTGGGTGCACAGGCCCCTGATGG + Intronic
1088024658 11:105163346-105163368 GTTGGTGGACAGAGCCATGAAGG - Intergenic
1088458952 11:110062475-110062497 GTAAGTCCACAGAGAGCTGAAGG - Intergenic
1095249770 12:39964671-39964693 GTTGGTGCACAGGGTCCTGGAGG + Intronic
1095998764 12:48111998-48112020 GCCGCTGCACAGAGGCATGATGG + Intronic
1097616657 12:61891824-61891846 GTCAGTCCACAGAAGCCTGATGG + Intronic
1097685878 12:62690465-62690487 ATAGCTACACAGAGGCCTCAGGG + Intronic
1097687022 12:62700643-62700665 ATCATTGCACAGAGGCCTGATGG - Intronic
1097836105 12:64274126-64274148 GAAGGGGCCCTGAGGCCTGAGGG + Intronic
1101898113 12:108770632-108770654 GTAGGGGCACAGATTGCTGAAGG - Intergenic
1102034115 12:109761242-109761264 GGAAGAGCACAGAGGCCTGGGGG - Intronic
1102577185 12:113863170-113863192 GTGTTTGCACACAGGCCTGAAGG + Intronic
1102927739 12:116839513-116839535 GTAGGTGGACAGAGGTATAAGGG + Intronic
1105892135 13:24689437-24689459 GGAGGGGCACAGGGCCCTGAGGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1107635963 13:42392856-42392878 TTGGAGGCACAGAGGCCTGATGG + Intergenic
1107690404 13:42947873-42947895 GAAGGTGAGCAGAGCCCTGACGG - Intronic
1115793430 14:36905669-36905691 CTTTGTGCACAGAGGTCTGAAGG + Intronic
1117164628 14:53021135-53021157 GTAACTGCACACAGGCGTGAGGG - Intergenic
1117196104 14:53341554-53341576 GTAGGTCCAAAGAGGCCGGAAGG + Intergenic
1119171330 14:72538430-72538452 GTAGGTGAGCTGAGTCCTGAGGG + Intronic
1120241874 14:81959230-81959252 GTGGGTTCACCTAGGCCTGAAGG + Intergenic
1121085413 14:91142532-91142554 GTGGGGGCAGGGAGGCCTGAGGG - Intronic
1122084775 14:99291929-99291951 ATATGTGAACAGAGACCTGAAGG - Intergenic
1122150984 14:99726183-99726205 GTAGGTGAACCGTGGCCTGCAGG - Exonic
1122165554 14:99820847-99820869 GAAGGTGCACGGAGGCCCGGTGG + Intronic
1122640343 14:103155876-103155898 TTTGGGGCAGAGAGGCCTGAAGG + Intergenic
1122710315 14:103651938-103651960 GCAGGTGCACAAAGACCTGAAGG - Intronic
1125999565 15:44195762-44195784 GCTGGAGCACAGAGGCCAGACGG - Intergenic
1128252541 15:66173161-66173183 ATAGGTGCACTGTTGCCTGAGGG - Intronic
1128942955 15:71803229-71803251 GTAGATGAACTGAGGACTGAAGG - Intronic
1129198520 15:73984987-73985009 GAAGTTGAACAGAGGCCTGAAGG - Intronic
1130738231 15:86571993-86572015 GTTGGTGCACAAAGTCCTGAGGG + Intronic
1131177607 15:90219866-90219888 GTAGGTACACATGGGGCTGAAGG - Exonic
1131557811 15:93414563-93414585 GTACGTGGGCACAGGCCTGAGGG + Intergenic
1132408000 15:101556259-101556281 GTAGGTGCAGTGAGTCCTGGGGG + Intergenic
1133027946 16:2996823-2996845 GTAGGAGCACCGAGGACCGAGGG + Intergenic
1133631036 16:7621859-7621881 GTAATTGCACAGAGACCTTATGG - Intronic
1133647576 16:7778624-7778646 GTAGATTCACAGAGACCAGAAGG - Intergenic
1134220920 16:12353288-12353310 GTAGGTGTCCAGGGGCCAGATGG - Intronic
1136487412 16:30582411-30582433 GTAGGGGCACAGAGGGCTGTGGG - Exonic
1137017671 16:35393448-35393470 TTAGGGGCACAGAGGCTTGCGGG - Intergenic
1138137438 16:54535671-54535693 GTAGGTGCCCAGAGGGGTGAGGG + Intergenic
1138535696 16:57659228-57659250 GTAGGTGCACAGGGGGATGTGGG + Intronic
1139649641 16:68355884-68355906 GTGGGTGCAGAGAGGGCTGGGGG + Intronic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142180035 16:88663821-88663843 GGGGGTGCACACAGGCCCGAGGG + Intergenic
1142298028 16:89239938-89239960 GTGGGGGCACAGACGTCTGATGG + Intergenic
1142854465 17:2722180-2722202 GGAGGTGCCCAGAGGACTGTGGG - Intergenic
1143124384 17:4632186-4632208 CCAGGTGCACAGAGGCGTGTTGG + Exonic
1143623854 17:8096789-8096811 GTAGGTGCCCAGGGGCCTCTGGG + Exonic
1147306637 17:39568751-39568773 GTGGGGGCTCAGAGGCATGAAGG - Intergenic
1147988963 17:44321877-44321899 GTAGAGGCAGGGAGGCCTGAGGG - Intronic
1148091797 17:45026868-45026890 GTAGGTGCACATCCTCCTGAAGG + Intronic
1148194845 17:45705882-45705904 GGTGGTGAACAGAGGCCTCAAGG + Intergenic
1151524466 17:74654884-74654906 GTAATTGCACTGAGCCCTGAGGG - Intergenic
1151805589 17:76402959-76402981 GCAGGGGCAGAGAGGCCTGATGG + Intronic
1152779097 17:82218539-82218561 AGGGGTGCACAGAGCCCTGAAGG + Intergenic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1152828730 17:82484161-82484183 CTTGGTGCAAAGGGGCCTGAGGG - Intronic
1155840051 18:30632552-30632574 GCAGGTGCACAGTGGACAGATGG - Intergenic
1156828137 18:41457921-41457943 GCAGGTGCACGGAAGCCAGAGGG + Intergenic
1157172623 18:45422083-45422105 GTAGGGCCAAAGAGGCCCGAGGG + Intronic
1158692045 18:59669548-59669570 GTAGGTGCACATGGGCCCTAAGG - Intronic
1160558660 18:79742235-79742257 GTTGGTGGAGAGAGGCCTGAGGG + Intronic
1161808590 19:6459095-6459117 GTAGGTGCCCAGAGGATGGAGGG + Intronic
1162095326 19:8306649-8306671 GTAGGTGCAATTAGGCCTGAAGG - Intronic
1162451952 19:10760424-10760446 GGAGGTGCACTGGGGCGTGAAGG - Intronic
1162460626 19:10811999-10812021 ATAGACTCACAGAGGCCTGATGG - Intronic
1164720312 19:30427114-30427136 ATAGGTAAACAGAGGCCAGATGG - Intronic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1165151978 19:33766370-33766392 GTTGGGGGAGAGAGGCCTGAGGG - Intronic
1167824683 19:51961452-51961474 GAGCATGCACAGAGGCCTGAAGG + Intergenic
926119502 2:10234545-10234567 GCAGGTGGCCAGATGCCTGAAGG + Intergenic
926337476 2:11875192-11875214 GTAGGGGCACAGGGGGCGGAGGG - Intergenic
926389042 2:12368597-12368619 GTTGGAGAACAGAGGCCAGATGG + Intergenic
927711771 2:25330651-25330673 ATAGGGGCACAGAGCCCTGGTGG - Intronic
927850825 2:26498257-26498279 GAAGGTGGGCAGAGGCTTGAAGG + Intronic
928709132 2:33985049-33985071 GGAGGTTCACAGAGACCTTAAGG + Intergenic
930101749 2:47608781-47608803 GCATGTGCACAGAGGCATGTAGG - Intergenic
935217872 2:100988856-100988878 GGAGGAGCAGAGAGGCCTGGAGG - Intronic
937060114 2:118974675-118974697 GTAGGTGAACGGAGGCCTGGTGG + Intronic
937305259 2:120867010-120867032 GAAGGTGCACAGTGGCCTGGGGG + Intronic
942008018 2:171727988-171728010 GAAGGAGCACAGAAGCCTAATGG - Intronic
944508654 2:200442391-200442413 GTAGCTGCATAGAGACCTTAAGG - Intronic
945254704 2:207793828-207793850 GAAGATGCACAGAGGACAGAAGG + Intergenic
948640029 2:239369864-239369886 GAAGTGGCACAGATGCCTGAAGG + Intronic
948803703 2:240444037-240444059 GCAGGCACCCAGAGGCCTGAGGG + Intronic
1168789150 20:564271-564293 TCATCTGCACAGAGGCCTGAAGG + Intergenic
1171238153 20:23544635-23544657 GTGGGTCAACAGAGGCCAGATGG - Intergenic
1172926339 20:38539813-38539835 GTAGGTGCACACAGAACTGATGG - Exonic
1174384577 20:50179515-50179537 GTAGGTGCTCAGTGACTTGAGGG - Intergenic
1176025753 20:62984746-62984768 CCGGGTGCACAGAGGCTTGAAGG + Intergenic
1179545456 21:42110116-42110138 GAAGCTGCAGAGAGGCCCGATGG + Intronic
1179826113 21:43967344-43967366 GCAGGTGGCCAGAGGCCTGCGGG - Intronic
1180876187 22:19176323-19176345 TGAGAGGCACAGAGGCCTGAAGG + Intronic
1181975565 22:26726911-26726933 GTAGAGGGACAAAGGCCTGAAGG + Intergenic
1182395141 22:30030099-30030121 GCAGGTGTTCAGAGGCATGAAGG + Intronic
1183106967 22:35621982-35622004 CCAGGTGCACAGCTGCCTGAGGG - Intronic
1183405648 22:37629455-37629477 GTGGGGTCACTGAGGCCTGAGGG - Exonic
1183673134 22:39284532-39284554 GGAGGTGCACAGAGGAGTGGCGG + Intergenic
1184012113 22:41757010-41757032 CAAGGTGTTCAGAGGCCTGAAGG - Intronic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184406686 22:44304543-44304565 GTGGGAGCAGAGAGGCCTGCGGG - Intronic
1184585331 22:45444106-45444128 TCAGGTGGGCAGAGGCCTGATGG + Intergenic
1184827782 22:46964778-46964800 GCAGGGGCACTGAGGGCTGAGGG + Intronic
949826535 3:8171330-8171352 ATTAGTACACAGAGGCCTGATGG + Intergenic
950442212 3:13016602-13016624 GCAGGTGCACACAGACCTCAGGG + Intronic
952228335 3:31402536-31402558 GCATGTGCACAGAGTCCTGCAGG + Intergenic
954681856 3:52350221-52350243 GTAGTTGGACAGAGGACAGATGG + Intronic
954863922 3:53712972-53712994 GTAGCTCCCCAGAGGCCTCAGGG - Intronic
956339463 3:68205435-68205457 TTAGGGTCACAGAGTCCTGATGG - Intronic
956994918 3:74814999-74815021 GCATGTGCACAGAAGCATGATGG - Intergenic
961447277 3:126986767-126986789 ACAGGGGCACAGAGGCCTGGGGG + Intergenic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
963271074 3:143286331-143286353 GCTGGTGCACACAGACCTGATGG + Intronic
965553303 3:169992693-169992715 ATGTGTGTACAGAGGCCTGAAGG - Exonic
966278508 3:178204043-178204065 GTGGGAGCACAAAGGACTGAGGG - Intergenic
966736234 3:183189331-183189353 GAAGGGGCACACAGGCCTGTGGG - Intronic
968040983 3:195589087-195589109 GTAGTTGAACAGAGACCTGCAGG + Intergenic
968199523 3:196740158-196740180 GTAAGTGCACACAGGCCGGCCGG + Intronic
968555235 4:1243556-1243578 GTGGGTGCACAGTGGCCCCAGGG - Intronic
969529088 4:7719929-7719951 GTAGGTGCACAGTGGGGTGGGGG - Intronic
971125721 4:23751868-23751890 GTAATTGCACAGAGGAGTGATGG + Intergenic
974683548 4:65195243-65195265 GTTGGTGCCCAAAGTCCTGAGGG + Intergenic
975461886 4:74663213-74663235 GGGCGTGCACAGAGGACTGAGGG + Intergenic
975853706 4:78600145-78600167 GTGGGAGGAGAGAGGCCTGATGG + Intronic
976782280 4:88774153-88774175 ATGCTTGCACAGAGGCCTGAAGG - Intronic
978797845 4:112725981-112726003 GTAGGTGCACAGAGCACTTGGGG + Intergenic
980556671 4:134415595-134415617 GAAATTGCACAGAGTCCTGATGG - Intergenic
980671098 4:136008459-136008481 GTTGGTGCCCAGAGTCCAGAGGG - Intergenic
982325183 4:154122588-154122610 ATGGGTGCAGGGAGGCCTGAGGG - Intergenic
985702383 5:1381397-1381419 GTAGGTGTGCACATGCCTGATGG - Intergenic
987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG + Intronic
988389417 5:30608105-30608127 GTATGTGCTCAGATGCCTGTAGG + Intergenic
997413163 5:133705480-133705502 GAACCTGCACAGAGGCCTGGTGG - Intergenic
997465777 5:134087247-134087269 GCAGGTGCACACAGATCTGAGGG - Intergenic
997589024 5:135061724-135061746 GAAGGTACACAGAGGTCAGAGGG - Intronic
997642454 5:135458228-135458250 GTAGGTGCACAAAACCCAGAGGG + Intergenic
999409990 5:151342337-151342359 GAAGGTGGACAGGGGCCTGGAGG - Intronic
1002054342 5:176590147-176590169 GTGAGTGCCCAGAGGCCTGGGGG + Intronic
1002506203 5:179680843-179680865 ATAGGTGGACAGAGGCTGGATGG + Intronic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1002622505 5:180498366-180498388 ATAGGTGCACAGAGTGCTGTGGG + Intronic
1002826103 6:775772-775794 GTAGGTGCACATTTGCCTCAGGG - Intergenic
1002856103 6:1039558-1039580 GAGGTTGCACAGAGGCCTGAGGG - Intergenic
1003006801 6:2389998-2390020 ATAAATGTACAGAGGCCTGAGGG - Intergenic
1004527884 6:16426296-16426318 GAAGGTGCAGAGAGGACAGAAGG + Intronic
1009867599 6:69416812-69416834 GTAGTTGGACAGAAGCCTCAAGG + Intergenic
1012350988 6:98249819-98249841 GTAGCTGCACAGAAACCTGAAGG + Intergenic
1014944086 6:127476177-127476199 GGTGGAGAACAGAGGCCTGAAGG - Exonic
1014955528 6:127610794-127610816 GTAAGAGGACAGAGGGCTGATGG + Intergenic
1016360682 6:143264505-143264527 GGAGGTGCACAGAGCCATGGTGG + Intronic
1017181935 6:151562845-151562867 GTAGGTGTGCTGAGGCCTTAGGG + Intronic
1020767150 7:12337068-12337090 GTAGGATCACAGATGCCTTAAGG + Exonic
1022742532 7:33137118-33137140 GTCGGTGCCCAGAGTCCGGAGGG + Intronic
1023230185 7:38019683-38019705 GTATGTGCACAGATGGCTTAGGG - Intronic
1024301223 7:47889120-47889142 GTGGGTGCACAGTGGGGTGATGG + Intronic
1024709232 7:51996355-51996377 GAACATGCACAGAGGCCAGAAGG - Intergenic
1025523762 7:61777729-61777751 GGGAGTGCACAGAGGCCTGGGGG - Intergenic
1025547121 7:62189932-62189954 GGGAGTGCACAGAGGCCTGGGGG - Intergenic
1025745258 7:64237216-64237238 GTAAGTGCCCAGAGGACTCATGG - Intronic
1031997957 7:128245268-128245290 GTGTGTGAACTGAGGCCTGAAGG - Intronic
1033547502 7:142414796-142414818 GTAGGAGCACAGAGACATCAGGG + Intergenic
1035617520 8:1013068-1013090 ATAGGTGCCCAGGGGCCGGAGGG - Intergenic
1035759488 8:2059008-2059030 GGAGGAGGACAGAGCCCTGACGG - Intronic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1038498378 8:28023412-28023434 GAAGCTGCACAGAAGCCTGAGGG - Exonic
1039119510 8:34130122-34130144 GTAGATTCACAGAGGCCTTGAGG + Intergenic
1039855410 8:41407821-41407843 GAAGGTGCACACAAGCCTGCAGG - Intergenic
1047682106 8:127264737-127264759 GTAAGTGGAGAGAGGCCTTAGGG - Intergenic
1047905236 8:129466023-129466045 TGAGGTGCACAAAGGCCAGATGG - Intergenic
1049858898 8:144883703-144883725 GAAGGTGCAGAGGGGCATGATGG + Intronic
1051387268 9:16522597-16522619 GTGGGAGCCAAGAGGCCTGAAGG + Intronic
1053161019 9:35813504-35813526 GGAAGTGCACAGGAGCCTGAGGG + Exonic
1056456276 9:86764010-86764032 GCAAAGGCACAGAGGCCTGAGGG + Intergenic
1057819942 9:98322777-98322799 GGAGGAGCCCAGAGGCCTGGAGG - Intronic
1060440342 9:123632828-123632850 GTACTTACACAGAGACCTGAGGG - Intronic
1060799278 9:126533367-126533389 GGGGGTTCACAGAGGCCTGCGGG - Intergenic
1061283141 9:129608801-129608823 GCAGGTGCACAGGGTCCGGAAGG - Intergenic
1061866270 9:133493230-133493252 GCAGATGGACAGAAGCCTGAGGG - Intergenic
1061936737 9:133862033-133862055 CCAGGTGCACAGTGGCATGACGG + Intronic
1062713488 9:137989608-137989630 TTAGGAGCACAGATGCCAGAGGG + Intronic
1186637096 X:11418201-11418223 GTGGGTGCACAGAAGACTCAAGG + Intronic
1190456781 X:50634998-50635020 GTAGATGCTCAGAGCCCTGTTGG + Exonic
1191104070 X:56761424-56761446 GCATGTGCACAGAGGCCTGTTGG - Intergenic
1195569778 X:106385297-106385319 GTAGGTGCCCAAACTCCTGAGGG - Intergenic
1196983596 X:121242891-121242913 GTAGGTGCACAGATCACAGATGG - Intergenic
1197635346 X:128908614-128908636 GTGGTGGCACAGAGGCCTTATGG - Intergenic
1200671570 Y:6098704-6098726 GCATGTGCACAGAGTCCTCAAGG + Intergenic