ID: 1164838118

View in Genome Browser
Species Human (GRCh38)
Location 19:31371700-31371722
Sequence GCTGTGTGTAGAACTAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164838115_1164838118 11 Left 1164838115 19:31371666-31371688 CCAAGATATACATTTTTAAAGGA No data
Right 1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG No data
1164838112_1164838118 17 Left 1164838112 19:31371660-31371682 CCTGGCCCAAGATATACATTTTT No data
Right 1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG No data
1164838113_1164838118 12 Left 1164838113 19:31371665-31371687 CCCAAGATATACATTTTTAAAGG No data
Right 1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG No data
1164838110_1164838118 25 Left 1164838110 19:31371652-31371674 CCACCAAGCCTGGCCCAAGATAT No data
Right 1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG No data
1164838111_1164838118 22 Left 1164838111 19:31371655-31371677 CCAAGCCTGGCCCAAGATATACA No data
Right 1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164838118 Original CRISPR GCTGTGTGTAGAACTAACTC AGG Intergenic
No off target data available for this crispr