ID: 1164839314

View in Genome Browser
Species Human (GRCh38)
Location 19:31380629-31380651
Sequence CAGCCTCCTCTCAGCAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164839314_1164839319 -9 Left 1164839314 19:31380629-31380651 CCGTGGTTGCTGAGAGGAGGCTG No data
Right 1164839319 19:31380643-31380665 AGGAGGCTGCGGTCCTGGGGTGG No data
1164839314_1164839320 -2 Left 1164839314 19:31380629-31380651 CCGTGGTTGCTGAGAGGAGGCTG No data
Right 1164839320 19:31380650-31380672 TGCGGTCCTGGGGTGGTCCATGG No data
1164839314_1164839321 -1 Left 1164839314 19:31380629-31380651 CCGTGGTTGCTGAGAGGAGGCTG No data
Right 1164839321 19:31380651-31380673 GCGGTCCTGGGGTGGTCCATGGG No data
1164839314_1164839323 5 Left 1164839314 19:31380629-31380651 CCGTGGTTGCTGAGAGGAGGCTG No data
Right 1164839323 19:31380657-31380679 CTGGGGTGGTCCATGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164839314 Original CRISPR CAGCCTCCTCTCAGCAACCA CGG (reversed) Intergenic
No off target data available for this crispr