ID: 1164846124

View in Genome Browser
Species Human (GRCh38)
Location 19:31433956-31433978
Sequence GCCTCCATGAAACTAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164846124_1164846126 16 Left 1164846124 19:31433956-31433978 CCTTGGCTTAGTTTCATGGAGGC No data
Right 1164846126 19:31433995-31434017 CTAAGACTCGTCCAAGGCTCAGG No data
1164846124_1164846125 10 Left 1164846124 19:31433956-31433978 CCTTGGCTTAGTTTCATGGAGGC No data
Right 1164846125 19:31433989-31434011 AAATAACTAAGACTCGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164846124 Original CRISPR GCCTCCATGAAACTAAGCCA AGG (reversed) Intergenic
No off target data available for this crispr