ID: 1164852992

View in Genome Browser
Species Human (GRCh38)
Location 19:31500255-31500277
Sequence CATCAGAGCCTGGATCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164852992_1164853005 30 Left 1164852992 19:31500255-31500277 CCAGCCGGATCCAGGCTCTGATG No data
Right 1164853005 19:31500308-31500330 GCCCTGTGGGGTGCAGCTGTTGG No data
1164852992_1164853002 18 Left 1164852992 19:31500255-31500277 CCAGCCGGATCCAGGCTCTGATG No data
Right 1164853002 19:31500296-31500318 CCTTCTCCTCCAGCCCTGTGGGG No data
1164852992_1164852999 16 Left 1164852992 19:31500255-31500277 CCAGCCGGATCCAGGCTCTGATG No data
Right 1164852999 19:31500294-31500316 CTCCTTCTCCTCCAGCCCTGTGG No data
1164852992_1164853000 17 Left 1164852992 19:31500255-31500277 CCAGCCGGATCCAGGCTCTGATG No data
Right 1164853000 19:31500295-31500317 TCCTTCTCCTCCAGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164852992 Original CRISPR CATCAGAGCCTGGATCCGGC TGG (reversed) Intergenic
No off target data available for this crispr