ID: 1164853580

View in Genome Browser
Species Human (GRCh38)
Location 19:31503730-31503752
Sequence AAGTGCTGATGAGCTCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164853580_1164853583 -10 Left 1164853580 19:31503730-31503752 CCGCGGAGAGCTCATCAGCACTT No data
Right 1164853583 19:31503743-31503765 ATCAGCACTTTGGCAAACTTGGG No data
1164853580_1164853585 13 Left 1164853580 19:31503730-31503752 CCGCGGAGAGCTCATCAGCACTT No data
Right 1164853585 19:31503766-31503788 TCTCCACATACGGCTCAGCTAGG No data
1164853580_1164853584 3 Left 1164853580 19:31503730-31503752 CCGCGGAGAGCTCATCAGCACTT No data
Right 1164853584 19:31503756-31503778 CAAACTTGGGTCTCCACATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164853580 Original CRISPR AAGTGCTGATGAGCTCTCCG CGG (reversed) Intergenic
No off target data available for this crispr