ID: 1164855536

View in Genome Browser
Species Human (GRCh38)
Location 19:31517847-31517869
Sequence CCTCAAAGCCGGCGATTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164855536_1164855542 -3 Left 1164855536 19:31517847-31517869 CCCCATAATCGCCGGCTTTGAGG No data
Right 1164855542 19:31517867-31517889 AGGACTGACTGCAGTCTGAAGGG No data
1164855536_1164855541 -4 Left 1164855536 19:31517847-31517869 CCCCATAATCGCCGGCTTTGAGG No data
Right 1164855541 19:31517866-31517888 GAGGACTGACTGCAGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164855536 Original CRISPR CCTCAAAGCCGGCGATTATG GGG (reversed) Intergenic
No off target data available for this crispr