ID: 1164857295

View in Genome Browser
Species Human (GRCh38)
Location 19:31534970-31534992
Sequence CCGCATGTGGACATGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164857295_1164857303 -3 Left 1164857295 19:31534970-31534992 CCAGGCCCCATGTCCACATGCGG No data
Right 1164857303 19:31534990-31535012 CGGCCTGGCTGGCTCGTGCGTGG No data
1164857295_1164857306 7 Left 1164857295 19:31534970-31534992 CCAGGCCCCATGTCCACATGCGG No data
Right 1164857306 19:31535000-31535022 GGCTCGTGCGTGGAGCTCCTGGG No data
1164857295_1164857305 6 Left 1164857295 19:31534970-31534992 CCAGGCCCCATGTCCACATGCGG No data
Right 1164857305 19:31534999-31535021 TGGCTCGTGCGTGGAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164857295 Original CRISPR CCGCATGTGGACATGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr