ID: 1164857616 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:31537274-31537296 |
| Sequence | CTGGGTTATGGGAGGGTGAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164857616_1164857624 | 3 | Left | 1164857616 | 19:31537274-31537296 | CCTCTCACCCTCCCATAACCCAG | No data | ||
| Right | 1164857624 | 19:31537300-31537322 | TACTGCTGCCCCCACCTCCTGGG | No data | ||||
| 1164857616_1164857623 | 2 | Left | 1164857616 | 19:31537274-31537296 | CCTCTCACCCTCCCATAACCCAG | No data | ||
| Right | 1164857623 | 19:31537299-31537321 | TTACTGCTGCCCCCACCTCCTGG | No data | ||||
| 1164857616_1164857625 | 4 | Left | 1164857616 | 19:31537274-31537296 | CCTCTCACCCTCCCATAACCCAG | No data | ||
| Right | 1164857625 | 19:31537301-31537323 | ACTGCTGCCCCCACCTCCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164857616 | Original CRISPR | CTGGGTTATGGGAGGGTGAG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||