ID: 1164857616

View in Genome Browser
Species Human (GRCh38)
Location 19:31537274-31537296
Sequence CTGGGTTATGGGAGGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164857616_1164857624 3 Left 1164857616 19:31537274-31537296 CCTCTCACCCTCCCATAACCCAG No data
Right 1164857624 19:31537300-31537322 TACTGCTGCCCCCACCTCCTGGG No data
1164857616_1164857623 2 Left 1164857616 19:31537274-31537296 CCTCTCACCCTCCCATAACCCAG No data
Right 1164857623 19:31537299-31537321 TTACTGCTGCCCCCACCTCCTGG No data
1164857616_1164857625 4 Left 1164857616 19:31537274-31537296 CCTCTCACCCTCCCATAACCCAG No data
Right 1164857625 19:31537301-31537323 ACTGCTGCCCCCACCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164857616 Original CRISPR CTGGGTTATGGGAGGGTGAG AGG (reversed) Intergenic
No off target data available for this crispr