ID: 1164859250

View in Genome Browser
Species Human (GRCh38)
Location 19:31549780-31549802
Sequence TGGTCCAGCACCTGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164859250_1164859253 -9 Left 1164859250 19:31549780-31549802 CCAGCCAGCCAGGTGCTGGACCA No data
Right 1164859253 19:31549794-31549816 GCTGGACCATCTCCGCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164859250 Original CRISPR TGGTCCAGCACCTGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr