ID: 1164859344

View in Genome Browser
Species Human (GRCh38)
Location 19:31550450-31550472
Sequence CAGAGTGAAGAGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164859343_1164859344 5 Left 1164859343 19:31550422-31550444 CCTCACATGGTGGCAGCAAGGAG 0: 5
1: 15
2: 39
3: 128
4: 518
Right 1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG No data
1164859341_1164859344 9 Left 1164859341 19:31550418-31550440 CCTTCCTCACATGGTGGCAGCAA 0: 10
1: 221
2: 585
3: 1515
4: 2234
Right 1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164859344 Original CRISPR CAGAGTGAAGAGAGTGAAGA TGG Intergenic
No off target data available for this crispr