ID: 1164861959

View in Genome Browser
Species Human (GRCh38)
Location 19:31568696-31568718
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164861959_1164861963 7 Left 1164861959 19:31568696-31568718 CCTAAAGTTCTCCACGGAGTGTC No data
Right 1164861963 19:31568726-31568748 CCCATTATGTCCCCAGCGCTGGG No data
1164861959_1164861961 6 Left 1164861959 19:31568696-31568718 CCTAAAGTTCTCCACGGAGTGTC No data
Right 1164861961 19:31568725-31568747 TCCCATTATGTCCCCAGCGCTGG No data
1164861959_1164861968 19 Left 1164861959 19:31568696-31568718 CCTAAAGTTCTCCACGGAGTGTC No data
Right 1164861968 19:31568738-31568760 CCAGCGCTGGGCTTTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164861959 Original CRISPR GACACTCCGTGGAGAACTTT AGG (reversed) Intergenic