ID: 1164861960

View in Genome Browser
Species Human (GRCh38)
Location 19:31568707-31568729
Sequence TGGGAATTTGTGACACTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164861960_1164861968 8 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861968 19:31568738-31568760 CCAGCGCTGGGCTTTGCATTTGG No data
1164861960_1164861963 -4 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861963 19:31568726-31568748 CCCATTATGTCCCCAGCGCTGGG No data
1164861960_1164861969 22 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861969 19:31568752-31568774 TGCATTTGGAATGTGAGCAGAGG No data
1164861960_1164861961 -5 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861961 19:31568725-31568747 TCCCATTATGTCCCCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164861960 Original CRISPR TGGGAATTTGTGACACTCCG TGG (reversed) Intergenic
No off target data available for this crispr