ID: 1164861961

View in Genome Browser
Species Human (GRCh38)
Location 19:31568725-31568747
Sequence TCCCATTATGTCCCCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164861960_1164861961 -5 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861961 19:31568725-31568747 TCCCATTATGTCCCCAGCGCTGG No data
1164861959_1164861961 6 Left 1164861959 19:31568696-31568718 CCTAAAGTTCTCCACGGAGTGTC No data
Right 1164861961 19:31568725-31568747 TCCCATTATGTCCCCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164861961 Original CRISPR TCCCATTATGTCCCCAGCGC TGG Intergenic
No off target data available for this crispr