ID: 1164861963

View in Genome Browser
Species Human (GRCh38)
Location 19:31568726-31568748
Sequence CCCATTATGTCCCCAGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164861959_1164861963 7 Left 1164861959 19:31568696-31568718 CCTAAAGTTCTCCACGGAGTGTC No data
Right 1164861963 19:31568726-31568748 CCCATTATGTCCCCAGCGCTGGG No data
1164861960_1164861963 -4 Left 1164861960 19:31568707-31568729 CCACGGAGTGTCACAAATTCCCA No data
Right 1164861963 19:31568726-31568748 CCCATTATGTCCCCAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164861963 Original CRISPR CCCATTATGTCCCCAGCGCT GGG Intergenic