ID: 1164861968 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:31568738-31568760 |
Sequence | CCAGCGCTGGGCTTTGCATT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164861960_1164861968 | 8 | Left | 1164861960 | 19:31568707-31568729 | CCACGGAGTGTCACAAATTCCCA | No data | ||
Right | 1164861968 | 19:31568738-31568760 | CCAGCGCTGGGCTTTGCATTTGG | No data | ||||
1164861959_1164861968 | 19 | Left | 1164861959 | 19:31568696-31568718 | CCTAAAGTTCTCCACGGAGTGTC | No data | ||
Right | 1164861968 | 19:31568738-31568760 | CCAGCGCTGGGCTTTGCATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164861968 | Original CRISPR | CCAGCGCTGGGCTTTGCATT TGG | Intergenic | ||