ID: 1164864279

View in Genome Browser
Species Human (GRCh38)
Location 19:31590952-31590974
Sequence CAGCTGTCCTTCAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164864273_1164864279 4 Left 1164864273 19:31590925-31590947 CCATGGACATCTTCTCATCCTTC 0: 1
1: 1
2: 2
3: 29
4: 332
Right 1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG 0: 1
1: 0
2: 4
3: 62
4: 410
1164864272_1164864279 5 Left 1164864272 19:31590924-31590946 CCCATGGACATCTTCTCATCCTT 0: 1
1: 0
2: 2
3: 16
4: 279
Right 1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG 0: 1
1: 0
2: 4
3: 62
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164864279 Original CRISPR CAGCTGTCCTTCAGGAAAGA GGG Intergenic
900303370 1:1989187-1989209 CCGCTGTCCGTCTGCAAAGACGG - Intronic
903011355 1:20332875-20332897 CAGCCGTTCTCCAGGGAAGAGGG - Exonic
904275894 1:29384135-29384157 CAGCTGGGCATCAGGAAGGAAGG + Intergenic
904843255 1:33388085-33388107 CAACTGTCCCACAGGAGAGAGGG + Intronic
905496864 1:38396840-38396862 AATCTGTCCTTCAGAAATGAAGG + Intergenic
906055624 1:42914551-42914573 AAACTGTCCTTCAGAAACGAAGG + Intergenic
907938735 1:59066606-59066628 AAACTGTGCTTCAGAAAAGAGGG - Intergenic
909048028 1:70734226-70734248 AGACTGTCCTTCAGGAATGAAGG - Intergenic
910527159 1:88193330-88193352 AAGCTATTTTTCAGGAAAGAGGG + Intergenic
910975267 1:92899874-92899896 AAGCTATCCTTCAGAAATGAGGG - Intronic
913281831 1:117192297-117192319 AAACTGTCCTTCAGAAATGAAGG + Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915703012 1:157813984-157814006 AAGCTGTCTTTCAGAAATGAAGG + Intronic
916258553 1:162816712-162816734 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
916268348 1:162915054-162915076 CAAATGTCCTTGAAGAAAGAAGG - Intergenic
916518342 1:165541102-165541124 CACCTGTCCTCCTGGAAGGATGG + Intergenic
916597197 1:166255669-166255691 AAGCTGTCCTTCATAAAAGAAGG - Intergenic
916795143 1:168160143-168160165 AAGCTATCCTTCAGAAATGAAGG - Intergenic
917313928 1:173705159-173705181 CAGACATCCTTCAGGAATGAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918115491 1:181492820-181492842 CTCCTGACCTTCAGGAAGGAGGG - Intronic
918417031 1:184320748-184320770 CAGCTGTCCATGAGGAGAGCTGG + Intergenic
918656296 1:187029944-187029966 AAGCTGTCCTTCAGAAGTGAAGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
919553175 1:199018490-199018512 TAGCTGTTCTGCAGGAAAGTGGG - Intergenic
920202467 1:204267975-204267997 CATCTGTCCATCAGGAAACCGGG + Intronic
923834653 1:237596902-237596924 AAGCTATCCTTCAGAAATGAAGG + Intronic
1062811303 10:468320-468342 CAGCCACCCTTCAGGAAAGCAGG - Intronic
1064034248 10:11902418-11902440 CAAATGCACTTCAGGAAAGAGGG - Intergenic
1065423280 10:25571306-25571328 CCACTGTCCTTCAGGACAGAGGG - Intronic
1066042073 10:31558553-31558575 GAGCTGTCTTTCAGAAATGAGGG + Intergenic
1066302333 10:34108127-34108149 CACCTGTCCTTTGGGAAAGATGG - Intergenic
1066724998 10:38382394-38382416 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
1067325822 10:45265504-45265526 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1067906633 10:50297859-50297881 CAGCTATCCTTCATAAATGAAGG + Intergenic
1068000589 10:51329663-51329685 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1070293960 10:75142862-75142884 CATTTGTCCTTCAGGATAGAAGG - Intronic
1070294567 10:75148795-75148817 CATTTGTCCTTCAGGATAGAAGG + Intronic
1070731617 10:78832371-78832393 CAGCTGTCCTGGAGACAAGATGG - Intergenic
1071004753 10:80869992-80870014 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1072020758 10:91397278-91397300 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1072543558 10:96416806-96416828 GAGTTGTCCTACATGAAAGAGGG - Intronic
1072860885 10:99004882-99004904 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1073600783 10:104844036-104844058 CAGCTTCTCTCCAGGAAAGAGGG + Intronic
1073993410 10:109289482-109289504 CAACTGTCCCTCTGCAAAGATGG - Intergenic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1075062671 10:119267682-119267704 AAACTGTCCTCCAGGAAAGGCGG + Intronic
1075232812 10:120698155-120698177 AAGCTGTTCTTCAGAAATGAAGG - Intergenic
1075791197 10:125085557-125085579 GAGCTTTCCTTCAGAAACGAGGG + Intronic
1076941422 10:133612500-133612522 AATCTGTCCTTCAGAAATGAAGG + Intergenic
1077343393 11:2035894-2035916 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1078147085 11:8729450-8729472 CAGGAGGCCTTCAGGAGAGAAGG + Intronic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1078840403 11:15072237-15072259 CGGCTTTCCTTCAGAAAAGATGG + Intronic
1079343970 11:19635873-19635895 CACCTATCCTTAAGGTAAGATGG - Intronic
1079935617 11:26612736-26612758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1080895958 11:36449023-36449045 CAGATGCCCTGCAGGAGAGAGGG - Intronic
1081644203 11:44778467-44778489 CAGCTGGCCTTCTAGAAGGAAGG + Intronic
1083040697 11:59682609-59682631 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1083124175 11:60546625-60546647 AAGCTATCCTTCAGAAACGAAGG + Intergenic
1083278703 11:61612076-61612098 CTGGTGTCCTTCTGAAAAGAAGG + Intergenic
1083391322 11:62352669-62352691 CAAATATCCTTCAGGAATGAAGG - Intronic
1083861221 11:65421348-65421370 CATCTGACCTTCAGCACAGAAGG - Intergenic
1086829448 11:91541656-91541678 AAGCTGTACTTCAGAAATGAGGG + Intergenic
1086880210 11:92145013-92145035 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1087182753 11:95156002-95156024 CCCCTGTCCTTCAGGTAACAGGG - Intergenic
1087533625 11:99415506-99415528 CAGCTGTTATGCAGAAAAGAGGG + Intronic
1088951196 11:114571875-114571897 CTGCTGTCCTACAGGCAGGATGG - Intronic
1089434214 11:118449800-118449822 CATCTTTCCTTCTGGGAAGATGG - Intronic
1090157054 11:124449787-124449809 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1090317035 11:125802050-125802072 AAACTGTCCTTCAGAAATGAAGG - Intergenic
1090499788 11:127250314-127250336 CAACTGTCCTTTGGGAAAGTGGG + Intergenic
1091034564 11:132221590-132221612 CAGCTGTCGTTCAGTAAGGCTGG - Intronic
1202826379 11_KI270721v1_random:91083-91105 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1092504650 12:9084092-9084114 AAGCTGTCTTTCAGAAATGAGGG + Intronic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1092907706 12:13116985-13117007 CAGCTGTCCTCTTGGGAAGAGGG - Intronic
1093339349 12:17951888-17951910 AAGCTGGCCTTCAGAAATGAAGG + Intergenic
1093339440 12:17953784-17953806 AAGCTGGCCTTCAGAAATGAAGG - Intergenic
1093383496 12:18522471-18522493 AAGTTGTCCTTCAGAAATGAGGG - Intronic
1094228057 12:28068735-28068757 GTGCTGTCCTTCAGAAATGAAGG + Intergenic
1094292025 12:28862249-28862271 GAGCTGTACTCCAGGAAACAGGG - Intergenic
1094801737 12:34045231-34045253 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095114871 12:38341138-38341160 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095803148 12:46289701-46289723 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1096608833 12:52787874-52787896 CAGCTGTGCTTTAGAAAAGCAGG - Intergenic
1097348794 12:58524863-58524885 CAGCTGGCCTACAGGAAATTTGG - Intergenic
1097358839 12:58633662-58633684 AAGCTATCCTTCAGAAAGGAAGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1098207212 12:68124482-68124504 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1106230382 13:27816838-27816860 AAGCTGTCCTTAAGAAGAGATGG - Intergenic
1106240707 13:27910638-27910660 CAGCTGCACTATAGGAAAGATGG + Intergenic
1107307474 13:39038079-39038101 CCTCTGGCTTTCAGGAAAGAGGG - Intergenic
1108945417 13:56017452-56017474 AAGCTGTCCTTCAGAAACAAAGG - Intergenic
1109241048 13:59888723-59888745 AAGTTGTCCTTCAGGCAAAAGGG - Intronic
1109373437 13:61456530-61456552 AAACTGTCCTTCAAAAAAGAAGG - Intergenic
1109653285 13:65355705-65355727 AAGCTGTACTTCAGAAATGAAGG + Intergenic
1112409117 13:99146833-99146855 CAGGTGTCCTTATGAAAAGAGGG - Intergenic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1113504630 13:110806794-110806816 CAGCTGGCCTTTAGGAAGCAGGG - Intergenic
1115303500 14:31911364-31911386 AAGCTGTACTTCAGAAATGAGGG - Intergenic
1115540369 14:34413840-34413862 AAGCTGTCCTTCAGATATGAAGG + Intronic
1116759965 14:48999790-48999812 CAGCTGTCATTGAAGATAGATGG + Intergenic
1117961913 14:61171642-61171664 CACCTTTTCTCCAGGAAAGAAGG - Intergenic
1118109887 14:62706791-62706813 CAGCTGTTCTCCAAGAAGGAGGG + Exonic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1118569501 14:67178966-67178988 AAGCTATCCTTCAGGAATGAGGG + Intronic
1118964336 14:70565973-70565995 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1119435275 14:74594417-74594439 CAGCTGAGCTTCAGGAATGGGGG - Intronic
1120588305 14:86344325-86344347 AAACTGTCCTTGAGAAAAGATGG - Intergenic
1121252527 14:92510664-92510686 CAGCTGTCCAACAGGAATGAGGG - Intergenic
1121399907 14:93665778-93665800 AAGCTATCCTTCAAGAATGAAGG + Intronic
1121638940 14:95472593-95472615 CTGCTGCCTTTCAGGAAGGAGGG - Intronic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1121876228 14:97456078-97456100 CAGCTGTTTGCCAGGAAAGAAGG - Intergenic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122455444 14:101846771-101846793 CAGTTCTCCTTCAGAAGAGAAGG - Intronic
1122583235 14:102784912-102784934 TGGCTGTCCTTCAGGGGAGAGGG + Intronic
1123908746 15:24945875-24945897 CATCTGTCCCACAGGAAAGCAGG - Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125980280 15:43994982-43995004 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1126624660 15:50674761-50674783 CAGCTCTCCTTTAGAAATGAAGG - Intronic
1127147897 15:56043583-56043605 CATCTGCCATGCAGGAAAGAGGG - Intergenic
1128021422 15:64394094-64394116 CAGCAGTGCTTCAAAAAAGATGG + Exonic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129112240 15:73344197-73344219 CAGCTGACCCTCAGGGAGGATGG - Intronic
1129567284 15:76636141-76636163 AAGCTTTCCTTCACAAAAGAAGG - Intronic
1129670591 15:77605754-77605776 CAGCTGCCCTGCAGGAGAAAGGG + Intergenic
1130218223 15:81993210-81993232 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1131004973 15:88970535-88970557 TAGCTATCCTTCAGAAATGAAGG - Intergenic
1132599109 16:766063-766085 AGCCTGTCCTTCAGGCAAGAAGG + Exonic
1132675388 16:1119250-1119272 CATCTCTCCCCCAGGAAAGAGGG - Intergenic
1132751076 16:1458014-1458036 CAGCTTTGCCTCAGGAAGGAAGG - Intronic
1133095274 16:3440842-3440864 CAGAGGTCCCTCAGCAAAGATGG - Exonic
1133375663 16:5284707-5284729 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
1133453881 16:5925780-5925802 AAGCTCCTCTTCAGGAAAGAGGG - Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1137880733 16:52045337-52045359 AAGATGTCCTTCAGAAATGAAGG - Intronic
1137973508 16:53010061-53010083 GAGCTGTCTTTCAGAAATGAAGG - Intergenic
1138096393 16:54215213-54215235 CCGCTTTCCTTCAGGGAAGCAGG + Intergenic
1138453547 16:57107582-57107604 CTGCTGTCCTCCAGGCAGGAAGG - Intronic
1138712398 16:58984288-58984310 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1140570626 16:76102488-76102510 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1141808016 16:86354737-86354759 CAGCTGTTCTTCAAGAAGGCTGG - Intergenic
1142023960 16:87802311-87802333 CAGGTGTCTTCCTGGAAAGATGG - Intergenic
1142552842 17:751780-751802 CAGCTGCCGTTCAGGAAATGAGG + Intronic
1142673194 17:1496958-1496980 TGGCTGGCCATCAGGAAAGAGGG + Intronic
1143265101 17:5630698-5630720 CAGCTGTCCCCCAGGGAAGTAGG + Intergenic
1143269812 17:5667248-5667270 CAGTTGTCTTTCAGGTAGGATGG - Intergenic
1143417170 17:6758656-6758678 CATCTCTCCTGCAGGGAAGATGG - Intronic
1143417217 17:6758847-6758869 CATCTCTCCTGCAGGGAAGATGG - Intronic
1143689445 17:8549135-8549157 AAGCTTTCCTTCAAAAAAGAGGG - Intronic
1144867224 17:18344354-18344376 CAGCTGACCTCCAGTAAAAATGG + Intronic
1146549988 17:33772113-33772135 CAGCTGGCTTTCAGGAAAAGGGG - Intronic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1146805791 17:35864210-35864232 CTGCTGGAGTTCAGGAAAGAAGG - Intronic
1148000892 17:44386240-44386262 GAGGTGTCATTGAGGAAAGATGG - Intronic
1148474198 17:47916379-47916401 CAGCTGCCCTCCAGGATAGGAGG - Exonic
1150830387 17:68512895-68512917 CCGTTGTCCTTCAGGAAATGGGG - Intronic
1150897636 17:69232796-69232818 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1151102805 17:71575104-71575126 CATATTTCCTTCAGGAACGATGG - Intergenic
1152392879 17:80013215-80013237 CAGCTGTCCTCCCGGAAGGAGGG - Intronic
1152696891 17:81802148-81802170 GACCTGTCCTCCAGGAAACAAGG + Intergenic
1153230860 18:2934318-2934340 GAGCTGTCCTTCAATAAATAAGG + Intronic
1153381912 18:4449796-4449818 CAGCTGAAGTCCAGGAAAGAGGG + Intronic
1155163230 18:23212219-23212241 CAGCTGGTCTGCAGTAAAGATGG + Intronic
1156521081 18:37722812-37722834 CAGCTGACCCCCAGGAAAGAGGG - Intergenic
1157458055 18:47855569-47855591 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1157616629 18:48991246-48991268 GAGCTCTCCTCCAGGAAGGAGGG + Intergenic
1157964889 18:52196899-52196921 TAGTTGGCCTTCAGGAAAGGAGG - Intergenic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160209396 18:76863744-76863766 TAAATGTCCTTCAGGAACGAAGG + Intronic
1160311746 18:77798900-77798922 AAACTATCCTTCAGGAATGAAGG - Intergenic
1160491167 18:79337589-79337611 CAGATGTCCCTAAGGAAGGAGGG - Intronic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1161228158 19:3157566-3157588 CAGCTGTCCATATGGAAACACGG + Intronic
1161734776 19:5984876-5984898 CAGCTGGGCTTCAGGAAAAGGGG + Intergenic
1161829974 19:6595640-6595662 AAGCTGTCCTTCCAGAAAGTTGG - Intronic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1163105466 19:15120592-15120614 CACAGGTCCTTCAGGAAAGTTGG - Intronic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1164946878 19:32302842-32302864 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1165301806 19:34974534-34974556 GAGTTGTGCTCCAGGAAAGAAGG + Intergenic
1166102365 19:40578286-40578308 CAGCCCTCTTTCAGGAGAGAAGG - Intronic
1166337050 19:42114605-42114627 TAGCTGTCCTTCACGGAACATGG - Intronic
1166995678 19:46718651-46718673 CATCTGCCCTTCAGGAAAAAGGG - Intergenic
1167728027 19:51232146-51232168 AAGCTATCTTTCAGAAAAGAAGG - Intronic
925311005 2:2881579-2881601 CAGCTGTGCTACATGCAAGAGGG - Intergenic
925488659 2:4367478-4367500 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
925508479 2:4597157-4597179 CAGCTATCCTTCATGGGAGAAGG - Intergenic
926891064 2:17639125-17639147 CAGTTGCCCTTCAGGGGAGAGGG + Intronic
927223207 2:20734873-20734895 AAAGTGTCTTTCAGGAAAGAAGG - Intronic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
928849218 2:35722196-35722218 AAGCTATCCTTCAGAAATGAAGG + Intergenic
929011503 2:37449801-37449823 CAGCTGGCGTCCAGGAAGGAAGG - Intergenic
929329698 2:40666413-40666435 TAGTTGTCCTTCATGAAACATGG + Intergenic
930049472 2:47203747-47203769 CAGTTGTCCTTCAGTATAGGTGG - Intergenic
930097046 2:47572685-47572707 CTGCTGTGCTCCAGAAAAGAGGG - Intergenic
930405259 2:50946898-50946920 AAACTGTCCATCAGGAAAGAAGG + Intronic
930963232 2:57286880-57286902 GAGCTTTCCTTTAAGAAAGAAGG - Intergenic
931149036 2:59552063-59552085 TACCTGTCCTTCATGAAACATGG - Intergenic
932445127 2:71776030-71776052 CAGCTATCTTCCAGGAAGGAGGG + Intergenic
932462355 2:71891216-71891238 GAGCTGACCTCCAGGATAGATGG + Intergenic
932837116 2:75048178-75048200 CAGCTGCACTTCTGGGAAGAGGG - Exonic
932872052 2:75410951-75410973 AATCTGTCCTTCAGGAATGAAGG + Intergenic
934693140 2:96377387-96377409 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
934878744 2:97952949-97952971 AAGCTATCCTTCAAAAAAGAAGG + Intronic
935483432 2:103621996-103622018 TAGCTGTCCTTTAGGAATAATGG + Intergenic
937919778 2:127120929-127120951 CAGCAGTCCTACAGAACAGAAGG - Intergenic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
939744621 2:145953345-145953367 TAGCTGTCATTCAGAAAGGAAGG - Intergenic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
940566736 2:155372816-155372838 CAACTTTCCTTCAAGATAGAAGG - Intergenic
941121490 2:161535628-161535650 CAGCTGTCTTTCTGAAATGAGGG + Intronic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
942586349 2:177483371-177483393 TAGCTGTACTTCATGAAAGTGGG - Intronic
943088012 2:183337756-183337778 AAACTGTCCTTCAGAAATGAGGG - Intergenic
943107283 2:183561156-183561178 CAGGTATCATTCAGTAAAGAAGG - Intergenic
944269117 2:197760996-197761018 AAGCTATCCTTCAGAAATGAAGG + Intronic
944665272 2:201954233-201954255 CAGCTGCCCTGAAGGAAAGCTGG + Intergenic
944935712 2:204565162-204565184 CAGGTGACCTCTAGGAAAGAAGG - Intronic
945412466 2:209527685-209527707 CCACTGTCCTTCATGAAGGAAGG - Intronic
946803583 2:223447547-223447569 CAATTGTTCCTCAGGAAAGATGG - Intergenic
947116250 2:226774288-226774310 TAACTGTCCTTCAAGGAAGAGGG + Intronic
947467705 2:230368214-230368236 AAGGTGTCCTTCAGAAATGAAGG - Intronic
947474323 2:230429189-230429211 AAGCTGTCCTTCAGAAGTGAAGG - Intronic
947690986 2:232135523-232135545 TAGCTGTTTTTCAGGGAAGAAGG + Intronic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948511923 2:238473677-238473699 AAGCTGTCTTTCAGTAATGAAGG - Intergenic
948514052 2:238492060-238492082 AAACTATCCTTCAGGAAGGAAGG - Intergenic
1169058260 20:2641537-2641559 CACCTGTCCTTTAGGGAAGCTGG + Exonic
1173717060 20:45217646-45217668 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173769226 20:45643864-45643886 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1174225264 20:48993692-48993714 CAGCTGAGCTTCAGGTAGGAGGG + Intronic
1174904722 20:54538370-54538392 AAAATGTCCTTCAGGAATGAAGG + Intronic
1175725074 20:61312576-61312598 CAGCTGGGCCTCAGCAAAGAAGG - Intronic
1176261720 20:64185385-64185407 CACCTGCCCCTCAGCAAAGAGGG - Intronic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178526409 21:33333234-33333256 AAACTATCCTTCAGGAATGAGGG + Intronic
1179119910 21:38534101-38534123 GAGCTGTCCAGCAGGAGAGAGGG - Intronic
1179667112 21:42920495-42920517 CACTTGTCCATCTGGAAAGAAGG - Intergenic
1180003390 21:45005706-45005728 TAGCTATCCTTCAGGAGTGAAGG - Intergenic
1181448358 22:22997840-22997862 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1182248916 22:28983970-28983992 CAGCAGCCCTTCAGGAAACTGGG - Intronic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1184243378 22:43223150-43223172 CAGCTGTCCTGCAGCAAGGCAGG - Exonic
949162900 3:902197-902219 AAGCTGTCCTTCAGCAATGAAGG + Intergenic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
950085340 3:10253467-10253489 CAACTGTCCTGGAGGTAAGAAGG - Intronic
950572331 3:13809169-13809191 CAGATGTCCTTATGGAGAGAAGG + Intergenic
950793577 3:15493070-15493092 TAGCTGTCTTTTGGGAAAGAGGG + Intronic
950841182 3:15969832-15969854 CAGATCCCCTTCAGGAAGGAAGG - Intergenic
951281978 3:20762278-20762300 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
951328352 3:21333287-21333309 AAGCTGACCTTCAGAAATGAGGG + Intergenic
952124718 3:30286995-30287017 GAGATGGCCTTAAGGAAAGAGGG - Intergenic
952439409 3:33310702-33310724 AAGCTGTCCTTCAGAAATGAAGG - Intronic
953420222 3:42748469-42748491 CAGCTGAACTTCAGGAAGCAGGG + Intronic
953472862 3:43181599-43181621 CACCTGTCCCCCAGGAAAGCTGG + Intergenic
954195344 3:48993356-48993378 CAGATGACTGTCAGGAAAGAGGG + Intronic
954384637 3:50237660-50237682 CAGCTGGCCTTTTGCAAAGACGG + Intronic
954400490 3:50317134-50317156 TGGCTGTCCCTGAGGAAAGAAGG - Intergenic
954868792 3:53751302-53751324 GTGCTGTCCTCCAGGAAAGGAGG - Intronic
954944044 3:54401651-54401673 AAGGTGTCCTTCAGGAATAAAGG + Intronic
955118739 3:56033615-56033637 AAGCTGTCCTTCAGAAATTAAGG - Intronic
955808466 3:62761140-62761162 CAGCTAAGCTTCAGAAAAGAAGG - Intronic
956162921 3:66373596-66373618 CATCTGTCTTTCAGGCAGGAAGG + Intronic
956298767 3:67745514-67745536 CTGCTGTCGTCCAAGAAAGATGG + Intergenic
958962442 3:100522954-100522976 CACCTGTCCTTCTAGAAGGAAGG + Intronic
960206834 3:114912174-114912196 AAGCTGTCCTTCAAAAATGAAGG + Intronic
960279617 3:115766643-115766665 AAGCTGTCCTGCAGGGAAGGAGG + Intergenic
962036387 3:131656088-131656110 AAGCACTCCTTCAGGAATGAGGG - Intronic
962433192 3:135339173-135339195 CAACTATTCTTCAGGAATGAAGG + Intergenic
962531014 3:136280280-136280302 AAACTATCCTTCAAGAAAGAAGG - Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
964521076 3:157568014-157568036 AAGGTGTCCTTCAGAAATGAAGG - Intronic
966017308 3:175156778-175156800 CAGCTGACCTACAGAAAAGTGGG + Intronic
966399872 3:179537265-179537287 GAGCTGTTCTTCAGGAGAGGAGG + Intergenic
966748503 3:183300627-183300649 CACCTGTCCTTGAGGAGAGTGGG + Intronic
966950822 3:184815718-184815740 CAGTTGCCCTCCAGGAAAGGTGG + Intronic
967381792 3:188867136-188867158 CAGCTGTAATACAGGAAAGAAGG - Intronic
967709605 3:192690054-192690076 AAGCTGTCTTTCAGAAAAGAGGG + Intronic
967779630 3:193421318-193421340 AAGCTGTCCTTCAGAAGTGAAGG + Intronic
967835006 3:193954870-193954892 AAACTATCCTTCAGGAATGAAGG - Intergenic
968991469 4:3916177-3916199 CAGATGCCTTTGAGGAAAGATGG + Intergenic
969695591 4:8732434-8732456 CAGCTGTCCTTCTGGCTTGATGG - Intergenic
970328544 4:14954786-14954808 GAGCTCTCCATCAGGAAGGATGG - Intergenic
972159165 4:36201417-36201439 CAGAATTCCTTCAGGAAAAAAGG + Intronic
972902784 4:43705312-43705334 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
973579618 4:52330059-52330081 AAGCTGTCATTCAGAAATGAAGG - Intergenic
973678356 4:53288653-53288675 AAGCTTTCCTTCAGGAATGAAGG + Intronic
973882126 4:55283968-55283990 TAGCTGTCCTTCAGAAATAAAGG - Intergenic
973975978 4:56262935-56262957 CAGCTGGCCCTAAGGGAAGAGGG + Intronic
974436387 4:61862449-61862471 CAACTGTAGTTCAGGAGAGAAGG + Intronic
974729085 4:65838028-65838050 CACCTGTCTGTCAGGAAACAGGG - Intergenic
975833535 4:78396470-78396492 AAGCTGTCATTCAGAAATGAAGG - Intronic
976040835 4:80882818-80882840 AAGCTATCCTTCAGAAATGAAGG + Intronic
976570388 4:86601151-86601173 TAGCTGTACTTCATGAAAGCTGG + Intronic
977459102 4:97301724-97301746 AAGCTGTCCTTCAGAAATGAAGG + Intronic
978117773 4:105042664-105042686 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
978417682 4:108494226-108494248 AAGCTGTCTTTTAGGAATGAAGG + Intergenic
978716077 4:111843705-111843727 CAGATGTCATTCAATAAAGAGGG - Intergenic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
979365906 4:119822962-119822984 AAGCTGTTCTTCAGAAATGAAGG + Intergenic
979964167 4:127057274-127057296 CAGCTATCCTTCAGAAAGGAAGG + Intergenic
980850910 4:138380234-138380256 GAGCTGTCCTTCAGGATTTATGG - Intergenic
983102842 4:163646290-163646312 AAGCTCTCCTTCAGAAATGAAGG + Intronic
983253676 4:165375061-165375083 GGCCTCTCCTTCAGGAAAGAAGG - Intronic
983488797 4:168363207-168363229 AAGCTATCCTTCAGAAATGAAGG + Intronic
983519913 4:168697399-168697421 CAGCTGTGCATCAGGAATGAAGG + Intronic
985076954 4:186225209-186225231 AAGCTGTCCTTCAGAAAGGAAGG - Intronic
985829078 5:2214503-2214525 CCTCTCTCCTTCAGGAGAGAGGG + Intergenic
987152207 5:15054842-15054864 TAGCTGTTCTTCAGAAATGAAGG - Intergenic
987634328 5:20520101-20520123 CAGATGTCCTTTTGAAAAGAGGG + Intronic
988310772 5:29554765-29554787 CATCTATACTTCAGGAATGAGGG - Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
989081634 5:37629012-37629034 AAGCTATCCTTCAGAAATGAAGG - Intronic
989148637 5:38274603-38274625 AAGCTGTCCTTCAGAAATGAAGG + Intronic
989623825 5:43410652-43410674 CAGCTCTCCTACAGGAAAGGAGG - Intronic
990237586 5:53784352-53784374 CAGCTGCCCTTGAGAAGAGATGG - Intergenic
990928833 5:61062955-61062977 AAGCTGTTCTTCAGAAATGAAGG + Intronic
991224137 5:64249461-64249483 AAGCTGTCCTTCACAAATGAAGG + Intronic
992272656 5:75081555-75081577 CAGATGACCTTCATGATAGAAGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
992804129 5:80320204-80320226 GAGCTGGCCATCAGGACAGAAGG - Exonic
993544803 5:89198473-89198495 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
994203659 5:97008152-97008174 TAGCTGTGCTTCAGGATATAGGG - Intronic
994429488 5:99639291-99639313 TACCTTTCCTTCAGGGAAGAAGG + Intergenic
995614530 5:113946191-113946213 AAGCTGTCCATCAGAAATGAAGG + Intergenic
996413539 5:123184863-123184885 GAGTTCTCCTTGAGGAAAGAAGG - Intronic
996454399 5:123663234-123663256 CAGCTGTCTTTCAAGACACAAGG + Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
997415059 5:133721517-133721539 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
997828516 5:137129179-137129201 GGCCTGTGCTTCAGGAAAGAAGG - Intronic
997833575 5:137174196-137174218 AAGCTTTCCTTCTGGAAAGAGGG + Intronic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
998555846 5:143123004-143123026 CATGTGTGCTTCAGGAAAGCAGG + Intronic
999085080 5:148880897-148880919 TAGCTGTCCAGCAGGAAAGTAGG + Intergenic
1002677023 5:180925552-180925574 AATCTGTCCTTCAGAAATGAGGG + Intronic
1003622837 6:7717048-7717070 AAGCTATCCTTCAAGAATGAAGG + Intergenic
1004965675 6:20848205-20848227 CATCTGCCCTGCAGAAAAGATGG + Intronic
1005417735 6:25619497-25619519 CAACGGTCCTCCAGTAAAGATGG + Exonic
1005889411 6:30124510-30124532 CAGCTGTCTTGCAGGAGAGAAGG - Intergenic
1006900552 6:37497950-37497972 CAGCTGTCCTACTGTAAACAAGG - Intronic
1008020503 6:46572407-46572429 AAGCTGTCCTTCAAAAATGAAGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008997631 6:57677061-57677083 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1009058533 6:58368951-58368973 AAACTGTCCTTCAGAAAATAAGG + Intergenic
1009186128 6:60576409-60576431 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1009232306 6:61078169-61078191 AAACTGTCCTTCAGAAAATAAGG - Intergenic
1009663426 6:66645550-66645572 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1009688074 6:66989353-66989375 AAGCTGTCCTTCAGAAAGGAGGG - Intergenic
1010323379 6:74539070-74539092 GAGGTCTCCTTGAGGAAAGATGG - Intergenic
1010856383 6:80845691-80845713 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1011296240 6:85829269-85829291 CAGTTATCCTTCATAAAAGAAGG + Intergenic
1011500518 6:87983343-87983365 AAGCTATCCTTCAGAAATGATGG + Intergenic
1011522986 6:88230149-88230171 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1013265032 6:108488065-108488087 CAAGTTTCCTTCTGGAAAGAAGG - Intronic
1013311755 6:108901074-108901096 AAGCCTTCCTACAGGAAAGAAGG + Intronic
1013950212 6:115771161-115771183 CAGCTGTCCTCCACCAGAGAGGG + Intergenic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1014932495 6:127350657-127350679 AGGCTGTCCTTCAGAAATGAAGG + Intergenic
1016793494 6:148091605-148091627 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1018248339 6:161843316-161843338 CAGCTGTCTCTCAGAGAAGATGG - Intronic
1019865040 7:3700102-3700124 AAACTATCCTTCAGGAATGAAGG + Intronic
1020014301 7:4821948-4821970 CATCTGTCCTTCTGGAATAACGG + Intronic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1021287763 7:18803524-18803546 AAGCTGTCTTTCAAGAATGAGGG - Intronic
1021630814 7:22645488-22645510 AAGCTGACCTTCAGAAATGAAGG - Intergenic
1022322814 7:29303254-29303276 CAAGTTTCCTTCTGGAAAGAAGG - Intronic
1022399769 7:30026234-30026256 CAGCTCTCCAGCAGGAAAGGTGG - Intronic
1022661080 7:32367082-32367104 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1022802437 7:33789031-33789053 CATCTGTCATTAATGAAAGACGG + Intergenic
1022855340 7:34308862-34308884 AAGCTGAGTTTCAGGAAAGAGGG + Intergenic
1024453048 7:49570924-49570946 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024811231 7:53214791-53214813 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024960722 7:54971830-54971852 CAGCTGTCCCTGCAGAAAGATGG - Intergenic
1024996720 7:55278170-55278192 CACCAGCCCTTCAGGAGAGATGG + Intergenic
1027350650 7:77307736-77307758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1028877453 7:95839807-95839829 AACCTGTCCTTCAGAAATGAAGG - Intronic
1030094371 7:105885127-105885149 CAGCTGTCCGTCAGGCCAGAAGG + Intronic
1030183476 7:106735689-106735711 AAACTGTCCTTCAGAAATGAGGG - Intergenic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1031077507 7:117226933-117226955 CAGGTGTCATCCAGGAAAGAAGG + Intronic
1031465126 7:122100156-122100178 CAAGTTTCCATCAGGAAAGAGGG + Intronic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033728591 7:144148542-144148564 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1034262757 7:149766871-149766893 AGGCTGTCCAGCAGGAAAGAAGG - Intronic
1035164630 7:156978994-156979016 AAGCTGTCCCTCAGTAATGAAGG - Intergenic
1035357803 7:158288913-158288935 AAGCTGTTCTTCAGAAATGAAGG - Intronic
1035724735 8:1817542-1817564 CAGATGCCCTCCAGGAAAGCAGG - Intergenic
1035929206 8:3762698-3762720 AAGCTGTCCGTCTGCAAAGATGG + Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1036998899 8:13694093-13694115 AAGCTGTCCTTCAGAAATTAAGG - Intergenic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038518874 8:28212048-28212070 GAGCTATCCTGCAGGCAAGATGG - Intergenic
1041806578 8:61856259-61856281 GAGCTATCCTTCAAGAATGAAGG + Intergenic
1041959173 8:63592758-63592780 TAGCTGTTCTTCAGAAATGAAGG - Intergenic
1041994416 8:64036335-64036357 AAGTTGTCCTTCAGCAATGAAGG + Intergenic
1042005931 8:64179830-64179852 AAGCTGTGCTTCAGAAATGAAGG + Intergenic
1042233341 8:66581848-66581870 AAGCTATCCTTCAGAAATGAGGG + Intronic
1042945673 8:74152421-74152443 CAGCTGTGGCTCAGGAAAGCTGG - Intergenic
1043113301 8:76215821-76215843 CAGCTGTACTCCAGGGAAGATGG - Intergenic
1043150413 8:76707609-76707631 CAGCTCTCCTGCAGTAAGGAGGG - Exonic
1043528279 8:81120511-81120533 CTGCAGTCCAGCAGGAAAGAAGG - Intergenic
1044765714 8:95572102-95572124 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1045586349 8:103541383-103541405 AAGCTGTTCTTCAGAAATGAAGG + Intronic
1045683350 8:104686302-104686324 CAGCCTTCCTTCAGGAAGGAAGG - Intronic
1046012268 8:108563803-108563825 AAAATGTCCTTCAGGAATGAAGG - Intergenic
1046880556 8:119302188-119302210 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1047265845 8:123308041-123308063 AAGCTGTCCTTCAAAAATGAGGG - Intergenic
1047788962 8:128182795-128182817 CAGCTGTGTTTCAGCAGAGAGGG + Intergenic
1049965813 9:778286-778308 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1050960001 9:11717979-11718001 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1051280681 9:15440421-15440443 AAACTATCCTTCAGGAATGAAGG - Intronic
1051851308 9:21512102-21512124 CTGCTGTCAGACAGGAAAGATGG + Intergenic
1052199623 9:25762761-25762783 AAGGTGTCCTTCAGAAACGAAGG + Intergenic
1052584880 9:30413804-30413826 TAGCTGTCCTTCAGAAATAAAGG - Intergenic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1053181455 9:35974906-35974928 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1054810844 9:69432735-69432757 CAGGGGGCTTTCAGGAAAGACGG - Intronic
1054879587 9:70130908-70130930 CAGCTGACATTCAAGGAAGAGGG + Intronic
1055363762 9:75522894-75522916 CAAATGTCCTTAAGGAATGAAGG + Intergenic
1055684034 9:78751456-78751478 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1056994280 9:91442181-91442203 AAGCTGTCCTTAAGAAATGAAGG - Intergenic
1057296203 9:93844068-93844090 AAGCTGTCCTTCAAGTATGAAGG - Intergenic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1059073897 9:111168695-111168717 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
1061187559 9:129063569-129063591 CAGCTTTTCTTCGGGAAAGTGGG + Exonic
1061348618 9:130046101-130046123 GAGCTATACTTCAGGAAACAAGG - Intergenic
1061520406 9:131114310-131114332 CAGCTGCCCTCCTGGTAAGAGGG + Intronic
1062727740 9:138085797-138085819 AAGCTATCCTTCAGAAATGAGGG + Intronic
1186997989 X:15144075-15144097 CAGATGTCCTTAAGAAAACAAGG - Intergenic
1187315826 X:18193947-18193969 AAATTGTCCCTCAGGAAAGAAGG + Intronic
1188138158 X:26514968-26514990 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1188393219 X:29646858-29646880 AAGCTGTCCTTCAGAAATGAAGG + Intronic
1188746069 X:33845996-33846018 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1189691269 X:43618839-43618861 TGTCTGTGCTTCAGGAAAGAAGG + Intergenic
1189875854 X:45434942-45434964 AAACTATCCTTCAGGAATGAAGG - Intergenic
1190156146 X:47994306-47994328 AAGTTATCCTTCAGGAATGAAGG + Intronic
1191700486 X:64036774-64036796 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1191968564 X:66788429-66788451 AAGCTATCCTTCAGGAATAAAGG + Intergenic
1192070877 X:67940182-67940204 CTGCTGTCTTTCTGGATAGAAGG - Intergenic
1192383187 X:70638388-70638410 AAGCTATCCTTCAGAAATGAAGG + Intronic
1192503968 X:71669829-71669851 CAGCTGTCCCACAGGAAATGGGG + Intergenic
1192715210 X:73633269-73633291 AAGCTGTCCTTTAGAAATGAAGG - Intronic
1194020666 X:88688094-88688116 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1194241767 X:91457712-91457734 CAGCTCAGCTTCAGGAAAGTAGG - Intergenic
1194877689 X:99209276-99209298 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1195237129 X:102911478-102911500 CAGCTGTCCCTAGGGAAAGTTGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196931189 X:120683656-120683678 CAACTGTCCTTGAGGAGGGAAGG + Intergenic
1197586662 X:128356325-128356347 CAGCTGGCCTTCTGAGAAGAGGG - Intergenic
1197682032 X:129395433-129395455 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1197758869 X:130014216-130014238 CACCTGTCCTGCAGGTAGGACGG - Exonic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
1199003404 X:142668005-142668027 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1199218430 X:145288943-145288965 AAGGTGTCCTTCAGAAATGAAGG - Intergenic
1199734717 X:150674874-150674896 CATCTTTCCTTCAGGAAATAGGG - Intergenic
1201341748 Y:12941826-12941848 CAGCTGTCCATAATGTAAGAGGG + Intergenic