ID: 1164875643

View in Genome Browser
Species Human (GRCh38)
Location 19:31684840-31684862
Sequence TTGGAATCACTAAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164875643_1164875648 16 Left 1164875643 19:31684840-31684862 CCTTTCTCCCTTAGTGATTCCAA No data
Right 1164875648 19:31684879-31684901 CATGACCTACTCCGCTGCTCAGG No data
1164875643_1164875646 -10 Left 1164875643 19:31684840-31684862 CCTTTCTCCCTTAGTGATTCCAA No data
Right 1164875646 19:31684853-31684875 GTGATTCCAATCTTAGTCAATGG No data
1164875643_1164875652 28 Left 1164875643 19:31684840-31684862 CCTTTCTCCCTTAGTGATTCCAA No data
Right 1164875652 19:31684891-31684913 CGCTGCTCAGGGAAAATCACTGG No data
1164875643_1164875649 17 Left 1164875643 19:31684840-31684862 CCTTTCTCCCTTAGTGATTCCAA No data
Right 1164875649 19:31684880-31684902 ATGACCTACTCCGCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164875643 Original CRISPR TTGGAATCACTAAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr