ID: 1164879018

View in Genome Browser
Species Human (GRCh38)
Location 19:31715186-31715208
Sequence GCATCGGTGGAACCCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164879018_1164879030 30 Left 1164879018 19:31715186-31715208 CCTTTGAGGGGTTCCACCGATGC No data
Right 1164879030 19:31715239-31715261 CCTTTCCCTCCTCTGACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164879018 Original CRISPR GCATCGGTGGAACCCCTCAA AGG (reversed) Intergenic
No off target data available for this crispr