ID: 1164879206

View in Genome Browser
Species Human (GRCh38)
Location 19:31716657-31716679
Sequence TGGGCTTCCTTGGGGCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164879198_1164879206 1 Left 1164879198 19:31716633-31716655 CCTACCCTGCTCAGAGATGCTTT No data
Right 1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG No data
1164879199_1164879206 -3 Left 1164879199 19:31716637-31716659 CCCTGCTCAGAGATGCTTTCTGG No data
Right 1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG No data
1164879197_1164879206 16 Left 1164879197 19:31716618-31716640 CCTGTGCAACATTGTCCTACCCT No data
Right 1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG No data
1164879201_1164879206 -4 Left 1164879201 19:31716638-31716660 CCTGCTCAGAGATGCTTTCTGGG No data
Right 1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164879206 Original CRISPR TGGGCTTCCTTGGGGCAAAC TGG Intergenic
No off target data available for this crispr