ID: 1164881691

View in Genome Browser
Species Human (GRCh38)
Location 19:31738307-31738329
Sequence ACTGCATAGAATTGAACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164881691_1164881693 15 Left 1164881691 19:31738307-31738329 CCAGAGGTTCAATTCTATGCAGT No data
Right 1164881693 19:31738345-31738367 TTACCTCGAATGGTCCCAGCTGG No data
1164881691_1164881692 5 Left 1164881691 19:31738307-31738329 CCAGAGGTTCAATTCTATGCAGT No data
Right 1164881692 19:31738335-31738357 TGCTTTTCATTTACCTCGAATGG No data
1164881691_1164881695 21 Left 1164881691 19:31738307-31738329 CCAGAGGTTCAATTCTATGCAGT No data
Right 1164881695 19:31738351-31738373 CGAATGGTCCCAGCTGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164881691 Original CRISPR ACTGCATAGAATTGAACCTC TGG (reversed) Intergenic
No off target data available for this crispr