ID: 1164881693

View in Genome Browser
Species Human (GRCh38)
Location 19:31738345-31738367
Sequence TTACCTCGAATGGTCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164881690_1164881693 16 Left 1164881690 19:31738306-31738328 CCCAGAGGTTCAATTCTATGCAG No data
Right 1164881693 19:31738345-31738367 TTACCTCGAATGGTCCCAGCTGG No data
1164881691_1164881693 15 Left 1164881691 19:31738307-31738329 CCAGAGGTTCAATTCTATGCAGT No data
Right 1164881693 19:31738345-31738367 TTACCTCGAATGGTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164881693 Original CRISPR TTACCTCGAATGGTCCCAGC TGG Intergenic
No off target data available for this crispr