ID: 1164884872

View in Genome Browser
Species Human (GRCh38)
Location 19:31769978-31770000
Sequence AATTGGGCCTCCAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164884872_1164884888 26 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884888 19:31770027-31770049 TCCATCTAGCAGGGGGAGGCAGG No data
1164884872_1164884885 18 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884885 19:31770019-31770041 GGTGAGCATCCATCTAGCAGGGG No data
1164884872_1164884887 22 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884887 19:31770023-31770045 AGCATCCATCTAGCAGGGGGAGG No data
1164884872_1164884883 16 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884883 19:31770017-31770039 AAGGTGAGCATCCATCTAGCAGG No data
1164884872_1164884877 -3 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884877 19:31769998-31770020 ATTTGACAAACCCCTGCCCAAGG No data
1164884872_1164884886 19 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884886 19:31770020-31770042 GTGAGCATCCATCTAGCAGGGGG No data
1164884872_1164884884 17 Left 1164884872 19:31769978-31770000 CCTGTGTCCCTGGAGGCCCAATT No data
Right 1164884884 19:31770018-31770040 AGGTGAGCATCCATCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164884872 Original CRISPR AATTGGGCCTCCAGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr