ID: 1164885038

View in Genome Browser
Species Human (GRCh38)
Location 19:31771277-31771299
Sequence AATCTGAGCCTCTGTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164885038_1164885043 0 Left 1164885038 19:31771277-31771299 CCCCCTCCACAGAGGCTCAGATT No data
Right 1164885043 19:31771300-31771322 TCATTTTTCTGATATAAGCCAGG No data
1164885038_1164885044 1 Left 1164885038 19:31771277-31771299 CCCCCTCCACAGAGGCTCAGATT No data
Right 1164885044 19:31771301-31771323 CATTTTTCTGATATAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164885038 Original CRISPR AATCTGAGCCTCTGTGGAGG GGG (reversed) Intergenic
No off target data available for this crispr