ID: 1164887809

View in Genome Browser
Species Human (GRCh38)
Location 19:31797904-31797926
Sequence TTCTTGCTTGGTGTGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887809_1164887815 10 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887809_1164887813 -5 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data
1164887809_1164887824 29 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887824 19:31797956-31797978 CAGGCACAGAGTGGGTGGGAAGG No data
1164887809_1164887821 24 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG No data
1164887809_1164887817 20 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887809_1164887822 25 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887809_1164887818 21 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887809 Original CRISPR TTCTTGCTTGGTGTGATCAA AGG (reversed) Intergenic
No off target data available for this crispr