ID: 1164887812

View in Genome Browser
Species Human (GRCh38)
Location 19:31797916-31797938
Sequence GCCACCTCTGGCTTCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887812_1164887815 -2 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887812_1164887817 8 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887812_1164887822 13 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887812_1164887825 20 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887825 19:31797959-31797981 GCACAGAGTGGGTGGGAAGGTGG No data
1164887812_1164887821 12 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG No data
1164887812_1164887818 9 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data
1164887812_1164887824 17 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887824 19:31797956-31797978 CAGGCACAGAGTGGGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887812 Original CRISPR GCCACCTCTGGCTTCTTGCT TGG (reversed) Intergenic
No off target data available for this crispr