ID: 1164887813

View in Genome Browser
Species Human (GRCh38)
Location 19:31797922-31797944
Sequence AAGAAGCCAGAGGTGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887808_1164887813 2 Left 1164887808 19:31797897-31797919 CCAGTCTCCTTTGATCACACCAA No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data
1164887805_1164887813 25 Left 1164887805 19:31797874-31797896 CCGCTTCACTCTCCTTGCATCCT No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data
1164887809_1164887813 -5 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data
1164887807_1164887813 5 Left 1164887807 19:31797894-31797916 CCTCCAGTCTCCTTTGATCACAC No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data
1164887806_1164887813 13 Left 1164887806 19:31797886-31797908 CCTTGCATCCTCCAGTCTCCTTT No data
Right 1164887813 19:31797922-31797944 AAGAAGCCAGAGGTGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887813 Original CRISPR AAGAAGCCAGAGGTGGCCAG AGG Intergenic
No off target data available for this crispr