ID: 1164887814

View in Genome Browser
Species Human (GRCh38)
Location 19:31797928-31797950
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887814_1164887827 24 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887827 19:31797975-31797997 AAGGTGGAGAGTTGACCTGGAGG No data
1164887814_1164887824 5 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887824 19:31797956-31797978 CAGGCACAGAGTGGGTGGGAAGG No data
1164887814_1164887822 1 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887814_1164887821 0 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG No data
1164887814_1164887818 -3 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data
1164887814_1164887825 8 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887825 19:31797959-31797981 GCACAGAGTGGGTGGGAAGGTGG No data
1164887814_1164887817 -4 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887814_1164887826 21 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887826 19:31797972-31797994 GGGAAGGTGGAGAGTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887814 Original CRISPR GTGACTCCTCTGGCCACCTC TGG (reversed) Intergenic
No off target data available for this crispr