ID: 1164887815

View in Genome Browser
Species Human (GRCh38)
Location 19:31797937-31797959
Sequence GCCAGAGGAGTCACCCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887807_1164887815 20 Left 1164887807 19:31797894-31797916 CCTCCAGTCTCCTTTGATCACAC No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887806_1164887815 28 Left 1164887806 19:31797886-31797908 CCTTGCATCCTCCAGTCTCCTTT No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887809_1164887815 10 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887812_1164887815 -2 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data
1164887808_1164887815 17 Left 1164887808 19:31797897-31797919 CCAGTCTCCTTTGATCACACCAA No data
Right 1164887815 19:31797937-31797959 GCCAGAGGAGTCACCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887815 Original CRISPR GCCAGAGGAGTCACCCTTCC AGG Intergenic
No off target data available for this crispr