ID: 1164887817

View in Genome Browser
Species Human (GRCh38)
Location 19:31797947-31797969
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887812_1164887817 8 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887814_1164887817 -4 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887807_1164887817 30 Left 1164887807 19:31797894-31797916 CCTCCAGTCTCCTTTGATCACAC No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887809_1164887817 20 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data
1164887808_1164887817 27 Left 1164887808 19:31797897-31797919 CCAGTCTCCTTTGATCACACCAA No data
Right 1164887817 19:31797947-31797969 TCACCCTTCCAGGCACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887817 Original CRISPR TCACCCTTCCAGGCACAGAG TGG Intergenic
No off target data available for this crispr