ID: 1164887818

View in Genome Browser
Species Human (GRCh38)
Location 19:31797948-31797970
Sequence CACCCTTCCAGGCACAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887808_1164887818 28 Left 1164887808 19:31797897-31797919 CCAGTCTCCTTTGATCACACCAA No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data
1164887809_1164887818 21 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data
1164887812_1164887818 9 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data
1164887814_1164887818 -3 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887818 19:31797948-31797970 CACCCTTCCAGGCACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887818 Original CRISPR CACCCTTCCAGGCACAGAGT GGG Intergenic
No off target data available for this crispr