ID: 1164887822

View in Genome Browser
Species Human (GRCh38)
Location 19:31797952-31797974
Sequence CTTCCAGGCACAGAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164887816_1164887822 -9 Left 1164887816 19:31797938-31797960 CCAGAGGAGTCACCCTTCCAGGC No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887809_1164887822 25 Left 1164887809 19:31797904-31797926 CCTTTGATCACACCAAGCAAGAA No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887812_1164887822 13 Left 1164887812 19:31797916-31797938 CCAAGCAAGAAGCCAGAGGTGGC No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data
1164887814_1164887822 1 Left 1164887814 19:31797928-31797950 CCAGAGGTGGCCAGAGGAGTCAC No data
Right 1164887822 19:31797952-31797974 CTTCCAGGCACAGAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164887822 Original CRISPR CTTCCAGGCACAGAGTGGGT GGG Intergenic
No off target data available for this crispr