ID: 1164888661

View in Genome Browser
Species Human (GRCh38)
Location 19:31804633-31804655
Sequence AAACCTACTCAAACCTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164888661_1164888665 16 Left 1164888661 19:31804633-31804655 CCCTAGTAGGTTTGAGTAGGTTT No data
Right 1164888665 19:31804672-31804694 CTTCCCACACCCCTGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164888661 Original CRISPR AAACCTACTCAAACCTACTA GGG (reversed) Intergenic
No off target data available for this crispr