ID: 1164890702

View in Genome Browser
Species Human (GRCh38)
Location 19:31820854-31820876
Sequence GCAGGTTCATCCATGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164890697_1164890702 17 Left 1164890697 19:31820814-31820836 CCATTTCTATTCTTGTTTCAAAA No data
Right 1164890702 19:31820854-31820876 GCAGGTTCATCCATGTGCTAGGG No data
1164890700_1164890702 -7 Left 1164890700 19:31820838-31820860 CCTGAAAGCTCAGAAGGCAGGTT No data
Right 1164890702 19:31820854-31820876 GCAGGTTCATCCATGTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164890702 Original CRISPR GCAGGTTCATCCATGTGCTA GGG Intergenic
No off target data available for this crispr