ID: 1164890729

View in Genome Browser
Species Human (GRCh38)
Location 19:31821095-31821117
Sequence CCTTCTAAGAAGAGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164890729_1164890732 -7 Left 1164890729 19:31821095-31821117 CCAGCTTTCCTCTTCTTAGAAGG No data
Right 1164890732 19:31821111-31821133 TAGAAGGACACCAGTCAGATCGG No data
1164890729_1164890735 14 Left 1164890729 19:31821095-31821117 CCAGCTTTCCTCTTCTTAGAAGG No data
Right 1164890735 19:31821132-31821154 GGATTAGAGCCCCACTCTAAGGG No data
1164890729_1164890734 13 Left 1164890729 19:31821095-31821117 CCAGCTTTCCTCTTCTTAGAAGG No data
Right 1164890734 19:31821131-31821153 CGGATTAGAGCCCCACTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164890729 Original CRISPR CCTTCTAAGAAGAGGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr