ID: 1164892600

View in Genome Browser
Species Human (GRCh38)
Location 19:31837626-31837648
Sequence GACCTCCATGTGCCTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164892598_1164892600 -3 Left 1164892598 19:31837606-31837628 CCTATGACACCTGTCAAAAAGAC No data
Right 1164892600 19:31837626-31837648 GACCTCCATGTGCCTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164892600 Original CRISPR GACCTCCATGTGCCTTCCCC AGG Intergenic
No off target data available for this crispr