ID: 1164896654

View in Genome Browser
Species Human (GRCh38)
Location 19:31882859-31882881
Sequence GTGAGCAAGGAGAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164896654_1164896663 5 Left 1164896654 19:31882859-31882881 CCAGCTGCCTTCTCCTTGCTCAC No data
Right 1164896663 19:31882887-31882909 GGGGCGGTGAAACACCAGAGTGG No data
1164896654_1164896665 13 Left 1164896654 19:31882859-31882881 CCAGCTGCCTTCTCCTTGCTCAC No data
Right 1164896665 19:31882895-31882917 GAAACACCAGAGTGGCATGAGGG No data
1164896654_1164896664 12 Left 1164896654 19:31882859-31882881 CCAGCTGCCTTCTCCTTGCTCAC No data
Right 1164896664 19:31882894-31882916 TGAAACACCAGAGTGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164896654 Original CRISPR GTGAGCAAGGAGAAGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr