ID: 1164898497

View in Genome Browser
Species Human (GRCh38)
Location 19:31898103-31898125
Sequence CTCAGGAAACATAATCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164898493_1164898497 -5 Left 1164898493 19:31898085-31898107 CCAAATGGCTGGGAAGGCCTCAG No data
Right 1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164898497 Original CRISPR CTCAGGAAACATAATCATGG TGG Intergenic
No off target data available for this crispr