ID: 1164903107

View in Genome Browser
Species Human (GRCh38)
Location 19:31945010-31945032
Sequence CTATTAAGTTGCAAATATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903107_1164903111 15 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG No data
1164903107_1164903110 6 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903110 19:31945039-31945061 AGAGATTTGTTTGTCTCCTTGGG No data
1164903107_1164903113 22 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903113 19:31945055-31945077 CCTTGGGAGAAACAGGAAAGTGG No data
1164903107_1164903114 23 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903114 19:31945056-31945078 CTTGGGAGAAACAGGAAAGTGGG No data
1164903107_1164903109 5 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903109 19:31945038-31945060 TAGAGATTTGTTTGTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903107 Original CRISPR CTATTAAGTTGCAAATATAT CGG (reversed) Intergenic
No off target data available for this crispr