ID: 1164903111

View in Genome Browser
Species Human (GRCh38)
Location 19:31945048-31945070
Sequence TTTGTCTCCTTGGGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903107_1164903111 15 Left 1164903107 19:31945010-31945032 CCGATATATTTGCAACTTAATAG No data
Right 1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG No data
1164903108_1164903111 -9 Left 1164903108 19:31945034-31945056 CCTTTAGAGATTTGTTTGTCTCC No data
Right 1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903111 Original CRISPR TTTGTCTCCTTGGGAGAAAC AGG Intergenic
No off target data available for this crispr