ID: 1164903948

View in Genome Browser
Species Human (GRCh38)
Location 19:31951676-31951698
Sequence AGGGTGTGAACATTTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903948_1164903959 19 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903959 19:31951718-31951740 TGTTAACTCACATGACAAAAGGG No data
1164903948_1164903958 18 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903948_1164903952 -9 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903952 19:31951690-31951712 TCACACCCTAAGCCTGGTCCTGG No data
1164903948_1164903953 -8 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903953 19:31951691-31951713 CACACCCTAAGCCTGGTCCTGGG No data
1164903948_1164903960 29 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903960 19:31951728-31951750 CATGACAAAAGGGACTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903948 Original CRISPR AGGGTGTGAACATTTTGATG GGG (reversed) Intergenic
No off target data available for this crispr